ID: 1035485665

View in Genome Browser
Species Human (GRCh38)
Location 7:159223213-159223235
Sequence CAGTAGGCACAGTTAGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035485658_1035485665 -9 Left 1035485658 7:159223199-159223221 CCCTCCAGCATGGCCAGTAGGCA No data
Right 1035485665 7:159223213-159223235 CAGTAGGCACAGTTAGGGCAGGG No data
1035485654_1035485665 6 Left 1035485654 7:159223184-159223206 CCTGGAGGGTCTGACCCCTCCAG No data
Right 1035485665 7:159223213-159223235 CAGTAGGCACAGTTAGGGCAGGG No data
1035485659_1035485665 -10 Left 1035485659 7:159223200-159223222 CCTCCAGCATGGCCAGTAGGCAC No data
Right 1035485665 7:159223213-159223235 CAGTAGGCACAGTTAGGGCAGGG No data
1035485657_1035485665 -8 Left 1035485657 7:159223198-159223220 CCCCTCCAGCATGGCCAGTAGGC No data
Right 1035485665 7:159223213-159223235 CAGTAGGCACAGTTAGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035485665 Original CRISPR CAGTAGGCACAGTTAGGGCA GGG Intergenic
No off target data available for this crispr