ID: 1035487462

View in Genome Browser
Species Human (GRCh38)
Location 7:159237175-159237197
Sequence GTGGCCTGGTGGCTATAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035487462_1035487475 23 Left 1035487462 7:159237175-159237197 CCCAGCTATAGCCACCAGGCCAC No data
Right 1035487475 7:159237221-159237243 TCCGACTACCACTGAGGGGAGGG No data
1035487462_1035487472 19 Left 1035487462 7:159237175-159237197 CCCAGCTATAGCCACCAGGCCAC No data
Right 1035487472 7:159237217-159237239 AACCTCCGACTACCACTGAGGGG No data
1035487462_1035487470 17 Left 1035487462 7:159237175-159237197 CCCAGCTATAGCCACCAGGCCAC No data
Right 1035487470 7:159237215-159237237 GCAACCTCCGACTACCACTGAGG No data
1035487462_1035487471 18 Left 1035487462 7:159237175-159237197 CCCAGCTATAGCCACCAGGCCAC No data
Right 1035487471 7:159237216-159237238 CAACCTCCGACTACCACTGAGGG No data
1035487462_1035487474 22 Left 1035487462 7:159237175-159237197 CCCAGCTATAGCCACCAGGCCAC No data
Right 1035487474 7:159237220-159237242 CTCCGACTACCACTGAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035487462 Original CRISPR GTGGCCTGGTGGCTATAGCT GGG (reversed) Intergenic
No off target data available for this crispr