ID: 1035487463

View in Genome Browser
Species Human (GRCh38)
Location 7:159237176-159237198
Sequence GGTGGCCTGGTGGCTATAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035487463_1035487474 21 Left 1035487463 7:159237176-159237198 CCAGCTATAGCCACCAGGCCACC No data
Right 1035487474 7:159237220-159237242 CTCCGACTACCACTGAGGGGAGG No data
1035487463_1035487475 22 Left 1035487463 7:159237176-159237198 CCAGCTATAGCCACCAGGCCACC No data
Right 1035487475 7:159237221-159237243 TCCGACTACCACTGAGGGGAGGG No data
1035487463_1035487470 16 Left 1035487463 7:159237176-159237198 CCAGCTATAGCCACCAGGCCACC No data
Right 1035487470 7:159237215-159237237 GCAACCTCCGACTACCACTGAGG No data
1035487463_1035487472 18 Left 1035487463 7:159237176-159237198 CCAGCTATAGCCACCAGGCCACC No data
Right 1035487472 7:159237217-159237239 AACCTCCGACTACCACTGAGGGG No data
1035487463_1035487471 17 Left 1035487463 7:159237176-159237198 CCAGCTATAGCCACCAGGCCACC No data
Right 1035487471 7:159237216-159237238 CAACCTCCGACTACCACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035487463 Original CRISPR GGTGGCCTGGTGGCTATAGC TGG (reversed) Intergenic
No off target data available for this crispr