ID: 1035487465

View in Genome Browser
Species Human (GRCh38)
Location 7:159237186-159237208
Sequence TCCAGCACTGGGTGGCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035487465_1035487478 27 Left 1035487465 7:159237186-159237208 CCACCAGGCCACCCAGTGCTGGA No data
Right 1035487478 7:159237236-159237258 GGGGAGGGAGTGCACAGATCCGG No data
1035487465_1035487470 6 Left 1035487465 7:159237186-159237208 CCACCAGGCCACCCAGTGCTGGA No data
Right 1035487470 7:159237215-159237237 GCAACCTCCGACTACCACTGAGG No data
1035487465_1035487475 12 Left 1035487465 7:159237186-159237208 CCACCAGGCCACCCAGTGCTGGA No data
Right 1035487475 7:159237221-159237243 TCCGACTACCACTGAGGGGAGGG No data
1035487465_1035487479 28 Left 1035487465 7:159237186-159237208 CCACCAGGCCACCCAGTGCTGGA No data
Right 1035487479 7:159237237-159237259 GGGAGGGAGTGCACAGATCCGGG No data
1035487465_1035487472 8 Left 1035487465 7:159237186-159237208 CCACCAGGCCACCCAGTGCTGGA No data
Right 1035487472 7:159237217-159237239 AACCTCCGACTACCACTGAGGGG No data
1035487465_1035487474 11 Left 1035487465 7:159237186-159237208 CCACCAGGCCACCCAGTGCTGGA No data
Right 1035487474 7:159237220-159237242 CTCCGACTACCACTGAGGGGAGG No data
1035487465_1035487471 7 Left 1035487465 7:159237186-159237208 CCACCAGGCCACCCAGTGCTGGA No data
Right 1035487471 7:159237216-159237238 CAACCTCCGACTACCACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035487465 Original CRISPR TCCAGCACTGGGTGGCCTGG TGG (reversed) Intergenic
No off target data available for this crispr