ID: 1035487467

View in Genome Browser
Species Human (GRCh38)
Location 7:159237194-159237216
Sequence GCTTTTGATCCAGCACTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035487467_1035487478 19 Left 1035487467 7:159237194-159237216 CCACCCAGTGCTGGATCAAAAGC No data
Right 1035487478 7:159237236-159237258 GGGGAGGGAGTGCACAGATCCGG No data
1035487467_1035487470 -2 Left 1035487467 7:159237194-159237216 CCACCCAGTGCTGGATCAAAAGC No data
Right 1035487470 7:159237215-159237237 GCAACCTCCGACTACCACTGAGG No data
1035487467_1035487480 27 Left 1035487467 7:159237194-159237216 CCACCCAGTGCTGGATCAAAAGC No data
Right 1035487480 7:159237244-159237266 AGTGCACAGATCCGGGCCTGAGG No data
1035487467_1035487471 -1 Left 1035487467 7:159237194-159237216 CCACCCAGTGCTGGATCAAAAGC No data
Right 1035487471 7:159237216-159237238 CAACCTCCGACTACCACTGAGGG No data
1035487467_1035487472 0 Left 1035487467 7:159237194-159237216 CCACCCAGTGCTGGATCAAAAGC No data
Right 1035487472 7:159237217-159237239 AACCTCCGACTACCACTGAGGGG No data
1035487467_1035487475 4 Left 1035487467 7:159237194-159237216 CCACCCAGTGCTGGATCAAAAGC No data
Right 1035487475 7:159237221-159237243 TCCGACTACCACTGAGGGGAGGG No data
1035487467_1035487474 3 Left 1035487467 7:159237194-159237216 CCACCCAGTGCTGGATCAAAAGC No data
Right 1035487474 7:159237220-159237242 CTCCGACTACCACTGAGGGGAGG No data
1035487467_1035487481 28 Left 1035487467 7:159237194-159237216 CCACCCAGTGCTGGATCAAAAGC No data
Right 1035487481 7:159237245-159237267 GTGCACAGATCCGGGCCTGAGGG No data
1035487467_1035487479 20 Left 1035487467 7:159237194-159237216 CCACCCAGTGCTGGATCAAAAGC No data
Right 1035487479 7:159237237-159237259 GGGAGGGAGTGCACAGATCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035487467 Original CRISPR GCTTTTGATCCAGCACTGGG TGG (reversed) Intergenic