ID: 1035487469

View in Genome Browser
Species Human (GRCh38)
Location 7:159237198-159237220
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035487469_1035487471 -5 Left 1035487469 7:159237198-159237220 CCAGTGCTGGATCAAAAGCAACC No data
Right 1035487471 7:159237216-159237238 CAACCTCCGACTACCACTGAGGG No data
1035487469_1035487474 -1 Left 1035487469 7:159237198-159237220 CCAGTGCTGGATCAAAAGCAACC No data
Right 1035487474 7:159237220-159237242 CTCCGACTACCACTGAGGGGAGG No data
1035487469_1035487482 29 Left 1035487469 7:159237198-159237220 CCAGTGCTGGATCAAAAGCAACC No data
Right 1035487482 7:159237250-159237272 CAGATCCGGGCCTGAGGGTCAGG No data
1035487469_1035487475 0 Left 1035487469 7:159237198-159237220 CCAGTGCTGGATCAAAAGCAACC No data
Right 1035487475 7:159237221-159237243 TCCGACTACCACTGAGGGGAGGG No data
1035487469_1035487472 -4 Left 1035487469 7:159237198-159237220 CCAGTGCTGGATCAAAAGCAACC No data
Right 1035487472 7:159237217-159237239 AACCTCCGACTACCACTGAGGGG No data
1035487469_1035487480 23 Left 1035487469 7:159237198-159237220 CCAGTGCTGGATCAAAAGCAACC No data
Right 1035487480 7:159237244-159237266 AGTGCACAGATCCGGGCCTGAGG No data
1035487469_1035487478 15 Left 1035487469 7:159237198-159237220 CCAGTGCTGGATCAAAAGCAACC No data
Right 1035487478 7:159237236-159237258 GGGGAGGGAGTGCACAGATCCGG No data
1035487469_1035487479 16 Left 1035487469 7:159237198-159237220 CCAGTGCTGGATCAAAAGCAACC No data
Right 1035487479 7:159237237-159237259 GGGAGGGAGTGCACAGATCCGGG No data
1035487469_1035487470 -6 Left 1035487469 7:159237198-159237220 CCAGTGCTGGATCAAAAGCAACC No data
Right 1035487470 7:159237215-159237237 GCAACCTCCGACTACCACTGAGG No data
1035487469_1035487481 24 Left 1035487469 7:159237198-159237220 CCAGTGCTGGATCAAAAGCAACC No data
Right 1035487481 7:159237245-159237267 GTGCACAGATCCGGGCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035487469 Original CRISPR GGTTGCTTTTGATCCAGCAC TGG (reversed) Intergenic