ID: 1035487471

View in Genome Browser
Species Human (GRCh38)
Location 7:159237216-159237238
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035487465_1035487471 7 Left 1035487465 7:159237186-159237208 CCACCAGGCCACCCAGTGCTGGA No data
Right 1035487471 7:159237216-159237238 CAACCTCCGACTACCACTGAGGG No data
1035487467_1035487471 -1 Left 1035487467 7:159237194-159237216 CCACCCAGTGCTGGATCAAAAGC No data
Right 1035487471 7:159237216-159237238 CAACCTCCGACTACCACTGAGGG No data
1035487468_1035487471 -4 Left 1035487468 7:159237197-159237219 CCCAGTGCTGGATCAAAAGCAAC No data
Right 1035487471 7:159237216-159237238 CAACCTCCGACTACCACTGAGGG No data
1035487463_1035487471 17 Left 1035487463 7:159237176-159237198 CCAGCTATAGCCACCAGGCCACC No data
Right 1035487471 7:159237216-159237238 CAACCTCCGACTACCACTGAGGG No data
1035487466_1035487471 4 Left 1035487466 7:159237189-159237211 CCAGGCCACCCAGTGCTGGATCA No data
Right 1035487471 7:159237216-159237238 CAACCTCCGACTACCACTGAGGG No data
1035487462_1035487471 18 Left 1035487462 7:159237175-159237197 CCCAGCTATAGCCACCAGGCCAC No data
Right 1035487471 7:159237216-159237238 CAACCTCCGACTACCACTGAGGG No data
1035487469_1035487471 -5 Left 1035487469 7:159237198-159237220 CCAGTGCTGGATCAAAAGCAACC No data
Right 1035487471 7:159237216-159237238 CAACCTCCGACTACCACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035487471 Original CRISPR CAACCTCCGACTACCACTGA GGG Intergenic
No off target data available for this crispr