ID: 1035487476

View in Genome Browser
Species Human (GRCh38)
Location 7:159237222-159237244
Sequence TCCCTCCCCTCAGTGGTAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035487476_1035487482 5 Left 1035487476 7:159237222-159237244 CCGACTACCACTGAGGGGAGGGA No data
Right 1035487482 7:159237250-159237272 CAGATCCGGGCCTGAGGGTCAGG No data
1035487476_1035487480 -1 Left 1035487476 7:159237222-159237244 CCGACTACCACTGAGGGGAGGGA No data
Right 1035487480 7:159237244-159237266 AGTGCACAGATCCGGGCCTGAGG No data
1035487476_1035487485 14 Left 1035487476 7:159237222-159237244 CCGACTACCACTGAGGGGAGGGA No data
Right 1035487485 7:159237259-159237281 GCCTGAGGGTCAGGCTCAGAGGG No data
1035487476_1035487478 -9 Left 1035487476 7:159237222-159237244 CCGACTACCACTGAGGGGAGGGA No data
Right 1035487478 7:159237236-159237258 GGGGAGGGAGTGCACAGATCCGG No data
1035487476_1035487481 0 Left 1035487476 7:159237222-159237244 CCGACTACCACTGAGGGGAGGGA No data
Right 1035487481 7:159237245-159237267 GTGCACAGATCCGGGCCTGAGGG No data
1035487476_1035487479 -8 Left 1035487476 7:159237222-159237244 CCGACTACCACTGAGGGGAGGGA No data
Right 1035487479 7:159237237-159237259 GGGAGGGAGTGCACAGATCCGGG No data
1035487476_1035487484 13 Left 1035487476 7:159237222-159237244 CCGACTACCACTGAGGGGAGGGA No data
Right 1035487484 7:159237258-159237280 GGCCTGAGGGTCAGGCTCAGAGG No data
1035487476_1035487487 26 Left 1035487476 7:159237222-159237244 CCGACTACCACTGAGGGGAGGGA No data
Right 1035487487 7:159237271-159237293 GGCTCAGAGGGAAAGCCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035487476 Original CRISPR TCCCTCCCCTCAGTGGTAGT CGG (reversed) Intergenic
No off target data available for this crispr