ID: 1035487478

View in Genome Browser
Species Human (GRCh38)
Location 7:159237236-159237258
Sequence GGGGAGGGAGTGCACAGATC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035487466_1035487478 24 Left 1035487466 7:159237189-159237211 CCAGGCCACCCAGTGCTGGATCA No data
Right 1035487478 7:159237236-159237258 GGGGAGGGAGTGCACAGATCCGG No data
1035487468_1035487478 16 Left 1035487468 7:159237197-159237219 CCCAGTGCTGGATCAAAAGCAAC No data
Right 1035487478 7:159237236-159237258 GGGGAGGGAGTGCACAGATCCGG No data
1035487467_1035487478 19 Left 1035487467 7:159237194-159237216 CCACCCAGTGCTGGATCAAAAGC No data
Right 1035487478 7:159237236-159237258 GGGGAGGGAGTGCACAGATCCGG No data
1035487476_1035487478 -9 Left 1035487476 7:159237222-159237244 CCGACTACCACTGAGGGGAGGGA No data
Right 1035487478 7:159237236-159237258 GGGGAGGGAGTGCACAGATCCGG No data
1035487469_1035487478 15 Left 1035487469 7:159237198-159237220 CCAGTGCTGGATCAAAAGCAACC No data
Right 1035487478 7:159237236-159237258 GGGGAGGGAGTGCACAGATCCGG No data
1035487465_1035487478 27 Left 1035487465 7:159237186-159237208 CCACCAGGCCACCCAGTGCTGGA No data
Right 1035487478 7:159237236-159237258 GGGGAGGGAGTGCACAGATCCGG No data
1035487473_1035487478 -6 Left 1035487473 7:159237219-159237241 CCTCCGACTACCACTGAGGGGAG No data
Right 1035487478 7:159237236-159237258 GGGGAGGGAGTGCACAGATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035487478 Original CRISPR GGGGAGGGAGTGCACAGATC CGG Intergenic
No off target data available for this crispr