ID: 1035487480

View in Genome Browser
Species Human (GRCh38)
Location 7:159237244-159237266
Sequence AGTGCACAGATCCGGGCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035487469_1035487480 23 Left 1035487469 7:159237198-159237220 CCAGTGCTGGATCAAAAGCAACC No data
Right 1035487480 7:159237244-159237266 AGTGCACAGATCCGGGCCTGAGG No data
1035487467_1035487480 27 Left 1035487467 7:159237194-159237216 CCACCCAGTGCTGGATCAAAAGC No data
Right 1035487480 7:159237244-159237266 AGTGCACAGATCCGGGCCTGAGG No data
1035487477_1035487480 -8 Left 1035487477 7:159237229-159237251 CCACTGAGGGGAGGGAGTGCACA No data
Right 1035487480 7:159237244-159237266 AGTGCACAGATCCGGGCCTGAGG No data
1035487473_1035487480 2 Left 1035487473 7:159237219-159237241 CCTCCGACTACCACTGAGGGGAG No data
Right 1035487480 7:159237244-159237266 AGTGCACAGATCCGGGCCTGAGG No data
1035487476_1035487480 -1 Left 1035487476 7:159237222-159237244 CCGACTACCACTGAGGGGAGGGA No data
Right 1035487480 7:159237244-159237266 AGTGCACAGATCCGGGCCTGAGG No data
1035487468_1035487480 24 Left 1035487468 7:159237197-159237219 CCCAGTGCTGGATCAAAAGCAAC No data
Right 1035487480 7:159237244-159237266 AGTGCACAGATCCGGGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035487480 Original CRISPR AGTGCACAGATCCGGGCCTG AGG Intergenic
No off target data available for this crispr