ID: 1035487481

View in Genome Browser
Species Human (GRCh38)
Location 7:159237245-159237267
Sequence GTGCACAGATCCGGGCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035487477_1035487481 -7 Left 1035487477 7:159237229-159237251 CCACTGAGGGGAGGGAGTGCACA No data
Right 1035487481 7:159237245-159237267 GTGCACAGATCCGGGCCTGAGGG No data
1035487467_1035487481 28 Left 1035487467 7:159237194-159237216 CCACCCAGTGCTGGATCAAAAGC No data
Right 1035487481 7:159237245-159237267 GTGCACAGATCCGGGCCTGAGGG No data
1035487468_1035487481 25 Left 1035487468 7:159237197-159237219 CCCAGTGCTGGATCAAAAGCAAC No data
Right 1035487481 7:159237245-159237267 GTGCACAGATCCGGGCCTGAGGG No data
1035487469_1035487481 24 Left 1035487469 7:159237198-159237220 CCAGTGCTGGATCAAAAGCAACC No data
Right 1035487481 7:159237245-159237267 GTGCACAGATCCGGGCCTGAGGG No data
1035487476_1035487481 0 Left 1035487476 7:159237222-159237244 CCGACTACCACTGAGGGGAGGGA No data
Right 1035487481 7:159237245-159237267 GTGCACAGATCCGGGCCTGAGGG No data
1035487473_1035487481 3 Left 1035487473 7:159237219-159237241 CCTCCGACTACCACTGAGGGGAG No data
Right 1035487481 7:159237245-159237267 GTGCACAGATCCGGGCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035487481 Original CRISPR GTGCACAGATCCGGGCCTGA GGG Intergenic
No off target data available for this crispr