ID: 1035495057

View in Genome Browser
Species Human (GRCh38)
Location 7:159317451-159317473
Sequence ATTTATGGGCAGAAAATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035495057_1035495062 3 Left 1035495057 7:159317451-159317473 CCTTCCATTTTCTGCCCATAAAT No data
Right 1035495062 7:159317477-159317499 CTTCTACCACATGGCTGTGCTGG No data
1035495057_1035495061 -6 Left 1035495057 7:159317451-159317473 CCTTCCATTTTCTGCCCATAAAT No data
Right 1035495061 7:159317468-159317490 ATAAATCTTCTTCTACCACATGG 0: 10
1: 49
2: 147
3: 188
4: 369
1035495057_1035495064 25 Left 1035495057 7:159317451-159317473 CCTTCCATTTTCTGCCCATAAAT No data
Right 1035495064 7:159317499-159317521 GAGTCTCTCTGAGCCTGCTGTGG No data
1035495057_1035495065 30 Left 1035495057 7:159317451-159317473 CCTTCCATTTTCTGCCCATAAAT No data
Right 1035495065 7:159317504-159317526 TCTCTGAGCCTGCTGTGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035495057 Original CRISPR ATTTATGGGCAGAAAATGGA AGG (reversed) Intergenic
No off target data available for this crispr