ID: 1035504483

View in Genome Browser
Species Human (GRCh38)
Location 8:116389-116411
Sequence ATGGCTCCACACTGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035504480_1035504483 8 Left 1035504480 8:116358-116380 CCGACTGCTGGGTGCACGGCAGA No data
Right 1035504483 8:116389-116411 ATGGCTCCACACTGCCATCTTGG No data
1035504478_1035504483 14 Left 1035504478 8:116352-116374 CCACAGCCGACTGCTGGGTGCAC No data
Right 1035504483 8:116389-116411 ATGGCTCCACACTGCCATCTTGG No data
1035504477_1035504483 15 Left 1035504477 8:116351-116373 CCCACAGCCGACTGCTGGGTGCA No data
Right 1035504483 8:116389-116411 ATGGCTCCACACTGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035504483 Original CRISPR ATGGCTCCACACTGCCATCT TGG Intergenic
No off target data available for this crispr