ID: 1035506007

View in Genome Browser
Species Human (GRCh38)
Location 8:132185-132207
Sequence ATACAGAAAAGGAAAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035506003_1035506007 10 Left 1035506003 8:132152-132174 CCATGGTAACCACTAAGTTAATA No data
Right 1035506007 8:132185-132207 ATACAGAAAAGGAAAGCAGAGGG No data
1035506004_1035506007 1 Left 1035506004 8:132161-132183 CCACTAAGTTAATATCTTTTGAA No data
Right 1035506007 8:132185-132207 ATACAGAAAAGGAAAGCAGAGGG No data
1035506001_1035506007 12 Left 1035506001 8:132150-132172 CCCCATGGTAACCACTAAGTTAA No data
Right 1035506007 8:132185-132207 ATACAGAAAAGGAAAGCAGAGGG No data
1035506002_1035506007 11 Left 1035506002 8:132151-132173 CCCATGGTAACCACTAAGTTAAT No data
Right 1035506007 8:132185-132207 ATACAGAAAAGGAAAGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035506007 Original CRISPR ATACAGAAAAGGAAAGCAGA GGG Intergenic
No off target data available for this crispr