ID: 1035506860

View in Genome Browser
Species Human (GRCh38)
Location 8:144711-144733
Sequence CTTTCCCCCATCGCAGCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035506859_1035506860 3 Left 1035506859 8:144685-144707 CCTCAGCAGTATGTGCTGGAATT No data
Right 1035506860 8:144711-144733 CTTTCCCCCATCGCAGCCTCAGG No data
1035506856_1035506860 29 Left 1035506856 8:144659-144681 CCTTCACAGCCATATTGTGGAAA No data
Right 1035506860 8:144711-144733 CTTTCCCCCATCGCAGCCTCAGG No data
1035506857_1035506860 20 Left 1035506857 8:144668-144690 CCATATTGTGGAAAACACCTCAG No data
Right 1035506860 8:144711-144733 CTTTCCCCCATCGCAGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035506860 Original CRISPR CTTTCCCCCATCGCAGCCTC AGG Intergenic
No off target data available for this crispr