ID: 1035519437

View in Genome Browser
Species Human (GRCh38)
Location 8:265698-265720
Sequence GTCTCCAGCCTGCGCTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035519437_1035519449 16 Left 1035519437 8:265698-265720 CCCACCCAGCGCAGGCTGGAGAC No data
Right 1035519449 8:265737-265759 TCTCGGGAGGCGGCGACTCCAGG No data
1035519437_1035519444 -9 Left 1035519437 8:265698-265720 CCCACCCAGCGCAGGCTGGAGAC No data
Right 1035519444 8:265712-265734 GCTGGAGACAAGATGGGGTGTGG No data
1035519437_1035519447 3 Left 1035519437 8:265698-265720 CCCACCCAGCGCAGGCTGGAGAC No data
Right 1035519447 8:265724-265746 ATGGGGTGTGGACTCTCGGGAGG No data
1035519437_1035519446 0 Left 1035519437 8:265698-265720 CCCACCCAGCGCAGGCTGGAGAC No data
Right 1035519446 8:265721-265743 AAGATGGGGTGTGGACTCTCGGG No data
1035519437_1035519445 -1 Left 1035519437 8:265698-265720 CCCACCCAGCGCAGGCTGGAGAC No data
Right 1035519445 8:265720-265742 CAAGATGGGGTGTGGACTCTCGG No data
1035519437_1035519448 6 Left 1035519437 8:265698-265720 CCCACCCAGCGCAGGCTGGAGAC No data
Right 1035519448 8:265727-265749 GGGTGTGGACTCTCGGGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035519437 Original CRISPR GTCTCCAGCCTGCGCTGGGT GGG (reversed) Intergenic
No off target data available for this crispr