ID: 1035524377

View in Genome Browser
Species Human (GRCh38)
Location 8:300906-300928
Sequence GCTTCCTCCCTGGGGCTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035524377_1035524386 22 Left 1035524377 8:300906-300928 CCACTGAGCCCCAGGGAGGAAGC No data
Right 1035524386 8:300951-300973 GAAGGTACAATCCGAGTGTGAGG No data
1035524377_1035524384 4 Left 1035524377 8:300906-300928 CCACTGAGCCCCAGGGAGGAAGC No data
Right 1035524384 8:300933-300955 GCCACTGGCTGTGCTGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035524377 Original CRISPR GCTTCCTCCCTGGGGCTCAG TGG (reversed) Intergenic
No off target data available for this crispr