ID: 1035525689

View in Genome Browser
Species Human (GRCh38)
Location 8:311400-311422
Sequence ACCCTAGGACATGAGCAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035525689_1035525693 2 Left 1035525689 8:311400-311422 CCAGGTTGCTCATGTCCTAGGGT No data
Right 1035525693 8:311425-311447 TTCCTGAGCATTTCAGACCTGGG No data
1035525689_1035525692 1 Left 1035525689 8:311400-311422 CCAGGTTGCTCATGTCCTAGGGT No data
Right 1035525692 8:311424-311446 CTTCCTGAGCATTTCAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035525689 Original CRISPR ACCCTAGGACATGAGCAACC TGG (reversed) Intergenic
No off target data available for this crispr