ID: 1035528853

View in Genome Browser
Species Human (GRCh38)
Location 8:335724-335746
Sequence CAAAAGGACGTGGCCACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035528847_1035528853 19 Left 1035528847 8:335682-335704 CCCAGGCAGAGCTCTGCAGAGCA No data
Right 1035528853 8:335724-335746 CAAAAGGACGTGGCCACAGCAGG No data
1035528850_1035528853 -4 Left 1035528850 8:335705-335727 CCAGTGTTTACACGCAGGACAAA No data
Right 1035528853 8:335724-335746 CAAAAGGACGTGGCCACAGCAGG No data
1035528848_1035528853 18 Left 1035528848 8:335683-335705 CCAGGCAGAGCTCTGCAGAGCAC No data
Right 1035528853 8:335724-335746 CAAAAGGACGTGGCCACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035528853 Original CRISPR CAAAAGGACGTGGCCACAGC AGG Intergenic
No off target data available for this crispr