ID: 1035530403

View in Genome Browser
Species Human (GRCh38)
Location 8:346302-346324
Sequence TGCCCTGGAATGACCCACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035530403_1035530407 4 Left 1035530403 8:346302-346324 CCAGCGTGGGTCATTCCAGGGCA No data
Right 1035530407 8:346329-346351 CAGAGCAGGTCTGTGTGTCCCGG No data
1035530403_1035530404 -10 Left 1035530403 8:346302-346324 CCAGCGTGGGTCATTCCAGGGCA No data
Right 1035530404 8:346315-346337 TTCCAGGGCAGCCGCAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035530403 Original CRISPR TGCCCTGGAATGACCCACGC TGG (reversed) Intergenic
No off target data available for this crispr