ID: 1035534744

View in Genome Browser
Species Human (GRCh38)
Location 8:382379-382401
Sequence GCAGAAGAGGCGGCCCTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035534744_1035534752 8 Left 1035534744 8:382379-382401 CCCCACAGGGCCGCCTCTTCTGC No data
Right 1035534752 8:382410-382432 TCTCAGCACGAAGCGGGAGAAGG No data
1035534744_1035534755 18 Left 1035534744 8:382379-382401 CCCCACAGGGCCGCCTCTTCTGC No data
Right 1035534755 8:382420-382442 AAGCGGGAGAAGGAGGAGGCAGG No data
1035534744_1035534750 1 Left 1035534744 8:382379-382401 CCCCACAGGGCCGCCTCTTCTGC No data
Right 1035534750 8:382403-382425 ACTACTTTCTCAGCACGAAGCGG No data
1035534744_1035534754 14 Left 1035534744 8:382379-382401 CCCCACAGGGCCGCCTCTTCTGC No data
Right 1035534754 8:382416-382438 CACGAAGCGGGAGAAGGAGGAGG No data
1035534744_1035534751 2 Left 1035534744 8:382379-382401 CCCCACAGGGCCGCCTCTTCTGC No data
Right 1035534751 8:382404-382426 CTACTTTCTCAGCACGAAGCGGG No data
1035534744_1035534753 11 Left 1035534744 8:382379-382401 CCCCACAGGGCCGCCTCTTCTGC No data
Right 1035534753 8:382413-382435 CAGCACGAAGCGGGAGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035534744 Original CRISPR GCAGAAGAGGCGGCCCTGTG GGG (reversed) Intergenic
No off target data available for this crispr