ID: 1035536473

View in Genome Browser
Species Human (GRCh38)
Location 8:395070-395092
Sequence CTGGTGAAGGGGAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035536459_1035536473 23 Left 1035536459 8:395024-395046 CCAGCACAATGACCACACCCAGC No data
Right 1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG No data
1035536466_1035536473 -1 Left 1035536466 8:395048-395070 CCTCTGTTACCTGCGGTGAGCAC No data
Right 1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG No data
1035536465_1035536473 0 Left 1035536465 8:395047-395069 CCCTCTGTTACCTGCGGTGAGCA No data
Right 1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG No data
1035536461_1035536473 6 Left 1035536461 8:395041-395063 CCCAGCCCCTCTGTTACCTGCGG No data
Right 1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG No data
1035536460_1035536473 11 Left 1035536460 8:395036-395058 CCACACCCAGCCCCTCTGTTACC No data
Right 1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG No data
1035536463_1035536473 5 Left 1035536463 8:395042-395064 CCAGCCCCTCTGTTACCTGCGGT No data
Right 1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG No data
1035536464_1035536473 1 Left 1035536464 8:395046-395068 CCCCTCTGTTACCTGCGGTGAGC No data
Right 1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG No data
1035536458_1035536473 30 Left 1035536458 8:395017-395039 CCAGGGTCCAGCACAATGACCAC No data
Right 1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG No data
1035536468_1035536473 -10 Left 1035536468 8:395057-395079 CCTGCGGTGAGCACTGGTGAAGG No data
Right 1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035536473 Original CRISPR CTGGTGAAGGGGAATGAGGA AGG Intergenic
No off target data available for this crispr