ID: 1035539317

View in Genome Browser
Species Human (GRCh38)
Location 8:420167-420189
Sequence GGGGAATGAGACTGCCACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035539313_1035539317 4 Left 1035539313 8:420140-420162 CCAGCTAGAGATATAACAGTATG 0: 2
1: 0
2: 0
3: 2
4: 71
Right 1035539317 8:420167-420189 GGGGAATGAGACTGCCACAGTGG No data
1035539312_1035539317 25 Left 1035539312 8:420119-420141 CCATTTGGGGCAAGCAGCTGACC 0: 2
1: 0
2: 1
3: 6
4: 88
Right 1035539317 8:420167-420189 GGGGAATGAGACTGCCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035539317 Original CRISPR GGGGAATGAGACTGCCACAG TGG Intronic
No off target data available for this crispr