ID: 1035540521

View in Genome Browser
Species Human (GRCh38)
Location 8:433037-433059
Sequence CTTTTGCAATATCAGATCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 3, 1: 1, 2: 2, 3: 16, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035540521 Original CRISPR CTTTTGCAATATCAGATCTA TGG Intronic
900075127 1:808450-808472 CTTTTGCAATATCAGATCTATGG - Intergenic
906719173 1:47993307-47993329 ATTTTGCTCTATCAGATCTCTGG + Intronic
908152837 1:61321752-61321774 CTTTGCAAATATCAGATCCATGG - Intronic
909968579 1:81950601-81950623 CTTTGGTAATATAACATCTATGG + Intronic
910501295 1:87894500-87894522 CTTTTGGAAGATAAGATCTGAGG + Intergenic
910506449 1:87954763-87954785 CTTTTGCAGTGTCAGATTTGTGG + Intergenic
916156803 1:161858741-161858763 CTTTTGCATTTTCAGCTGTATGG - Intronic
917084050 1:171287670-171287692 CTTTTGCAATATCACTATTAAGG - Intergenic
917912458 1:179664096-179664118 CTTGTTCAAAAGCAGATCTAGGG + Intronic
918100469 1:181368698-181368720 CTTTTTCAAAATCAGTTCCATGG - Intergenic
921359722 1:214319520-214319542 GTTTACCAAAATCAGATCTAAGG + Intronic
922270967 1:224033349-224033371 CTTTTGCAATATCAGATCTATGG - Intergenic
922768262 1:228167196-228167218 CTTTTTCCATATCACATCTCTGG + Intronic
1063167650 10:3478670-3478692 CTTTTGGAATATCAGCTCCAGGG - Intergenic
1063359999 10:5445374-5445396 CTTTTGCAAATTCAAAACTAAGG - Intronic
1064323842 10:14330645-14330667 TTTTTGCAAAATCAGATATCTGG + Exonic
1065407111 10:25381271-25381293 ATTTGGCAACATCAGATCAATGG + Intronic
1065816118 10:29484273-29484295 CTTTTGCACTTTCAGATCAATGG + Intronic
1065956784 10:30700623-30700645 CTTTTGCACTTTCAGATCAATGG - Intergenic
1067317881 10:45186248-45186270 CTTGTGCAATATGAGAGTTAGGG - Intergenic
1067347943 10:45451412-45451434 TTTCTGCAATATCATATCTTTGG - Intergenic
1068062002 10:52079846-52079868 CTTTTACATTATTAGATATATGG + Intronic
1069289250 10:66756886-66756908 GTTTTGCAATTTCTGCTCTAGGG - Intronic
1069896119 10:71681207-71681229 CTTTAGTAATATAAAATCTAAGG - Intronic
1071104750 10:82081229-82081251 CTCTTGGAATGTCAGATCTTGGG - Intronic
1071419003 10:85470472-85470494 TTTGTGCAATATCAGTTGTAAGG - Intergenic
1072901475 10:99411323-99411345 CTTTTCCACTTTCAGATCTTAGG - Intronic
1074266192 10:111905954-111905976 CTTTTAAACTATCAGATCTCAGG + Intergenic
1080028817 11:27639071-27639093 CTTTTGCAAAATGATAACTAAGG - Intergenic
1080165934 11:29236925-29236947 CCTTTGTAAGATCAGATCCACGG - Intergenic
1084350916 11:68598512-68598534 CTTTTGCATCTTCAGATCTCTGG + Intronic
1085080695 11:73631473-73631495 CTTTTAAATTATCAGATCCAGGG - Intergenic
1088900590 11:114113775-114113797 CTTTTTCAAAATCAATTCTATGG + Intronic
1090668099 11:128928297-128928319 CTTTTGCAATATGAGATCTCAGG + Intergenic
1090869645 11:130731974-130731996 TTTGTGCAATATCAGCTCTGGGG + Intergenic
1091614491 12:2039034-2039056 CTTTTGCAATTTCCTACCTATGG - Intronic
1093761689 12:22918281-22918303 CTTTTGCAAAATGAGAACTCAGG - Intergenic
1094281647 12:28746672-28746694 CTCTTGCAATATCTAATCTTAGG + Intergenic
1094303608 12:28993746-28993768 CTATTGCAATATCATATATCAGG + Intergenic
1099581259 12:84450075-84450097 CTTCTGTAAAATCAGATATATGG - Intergenic
1101130958 12:101690687-101690709 CTTTTGCAATTTCAGATAAAGGG + Intergenic
1101630922 12:106493950-106493972 CTTTGGCAATATCTGAACCAAGG - Intronic
1104679464 12:130739575-130739597 CTCTTGAAAAACCAGATCTAGGG + Intergenic
1110054907 13:70955396-70955418 TTCTTGGAATATCAAATCTATGG - Intergenic
1110148701 13:72224456-72224478 CTTTTGCCATATCTAACCTATGG + Intergenic
1110287520 13:73766900-73766922 CATTTGCAGTATTTGATCTATGG - Intronic
1110474408 13:75896984-75897006 CTGTTGCAATGACAGATCTCTGG + Intergenic
1110639010 13:77799915-77799937 CTTTTGCAAGATCAGAAATAAGG + Intergenic
1111212410 13:85096835-85096857 TTTTTGCAATATGAGACTTATGG - Intergenic
1112577429 13:100648142-100648164 CTGTGGCAATTTCAGATCAAAGG + Intronic
1113587367 13:111474581-111474603 CTTTAGAAATACCAGATCCAGGG - Intergenic
1114368626 14:22059129-22059151 CTTTTGCCATATCAGCAGTAAGG - Intergenic
1115036858 14:28868353-28868375 CTTTTGCAATAGCAAAACTAAGG - Intergenic
1115716799 14:36114536-36114558 CTCTTGCAAGGTCAGATCAAGGG - Intergenic
1116357193 14:43944163-43944185 GTTTTGGAATATCTTATCTATGG - Intergenic
1117626906 14:57649840-57649862 CTTTTGAAATATCAAATCTCTGG - Intronic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1117962212 14:61174606-61174628 CTTTTGCAGAGACAGATCTAGGG + Intergenic
1121028432 14:90634908-90634930 CTTTTGCTATGACACATCTAGGG - Intronic
1124827938 15:33117518-33117540 CTTTTGGAAAATCTGAACTACGG + Intronic
1133442339 16:5831277-5831299 CTTTTGAAAAACCAGATCTCTGG - Intergenic
1133986743 16:10674692-10674714 CTTTTGGAGTACCAGATCAACGG + Intronic
1137550717 16:49435714-49435736 CTTTAGAAATGTCAGATCTGGGG - Intergenic
1139246707 16:65451926-65451948 CATTTGTAATATCTGATCTCTGG + Intergenic
1151623888 17:75264510-75264532 CTTTTTCAATATCAACTCCATGG + Intronic
1156578042 18:38342285-38342307 ATTTTGGAATCTCAGATTTAGGG + Intergenic
1158423385 18:57315530-57315552 ATTTTGCAGTTTCAGATCTGAGG + Intergenic
1158795831 18:60845259-60845281 CTTATGCAATATAAGATTTAAGG + Intergenic
1159242142 18:65755133-65755155 CTTTTGCAATGTGTGATCTTTGG - Intronic
1159322562 18:66872170-66872192 TTTTTGCAAGTTCTGATCTATGG + Intergenic
1159461483 18:68726611-68726633 TTTTTGCAATATTAGATGTCAGG + Intronic
1161840190 19:6675348-6675370 CTTTTGCAAAATCATAACTGAGG + Intergenic
1163096623 19:15062654-15062676 CTTTTGCCACATCAGCTCCAAGG + Intergenic
1163986400 19:20955786-20955808 CTTTTTCAGTATTATATCTATGG + Intergenic
1166802836 19:45468812-45468834 CCTTTTCCATCTCAGATCTAGGG - Intronic
931975680 2:67641599-67641621 CTTTTGCAATTTCTCATCTAAGG + Intergenic
933612481 2:84451616-84451638 ATTTTACAACATCAGATCTTTGG + Intronic
935145538 2:100392747-100392769 CTTTTGCAGCATCAGATCTGAGG - Exonic
940274281 2:151922661-151922683 CATTTCCAGTATCAGATCTTTGG + Intronic
940317405 2:152339596-152339618 CTTGTGCAATATCAGGTGTCAGG + Intronic
940459825 2:153950648-153950670 CTTTTCCATTAATAGATCTATGG - Intronic
941946745 2:171107314-171107336 CTTTTGTAATAACTAATCTATGG + Intronic
942005291 2:171693688-171693710 TTTTAGAAATATCAGCTCTAAGG - Intronic
942162908 2:173210906-173210928 CCTTTGAAATATCTTATCTAGGG + Intronic
942612295 2:177754917-177754939 AGTTTCAAATATCAGATCTAGGG + Intronic
946627900 2:221634564-221634586 CTCTTGAAGTATAAGATCTAAGG - Intergenic
946836364 2:223776563-223776585 CCTTTGCAAGAGCATATCTAAGG + Intronic
946868345 2:224062821-224062843 CATTTGCAATAGGAAATCTATGG + Intergenic
947133174 2:226950867-226950889 CTAATGCATTATCAGATGTATGG + Intronic
947677681 2:231998462-231998484 GTTTTGAAACATCAGTTCTATGG - Intronic
949082595 2:242116334-242116356 CTTTTGCAATGTCAGATCTATGG + Intergenic
1175248332 20:57594451-57594473 TTTTTGCAAAAACAGATCAAGGG + Intergenic
1176877961 21:14153018-14153040 ACTTTTCAATAGCAGATCTAAGG + Intronic
1177325065 21:19575099-19575121 CATTTGAAATATCAAATATATGG - Intergenic
1177699992 21:24625960-24625982 GCTTTGTAATATAAGATCTAGGG + Intergenic
1178198587 21:30377336-30377358 CTTTTGTAAAGTCAGATCTGTGG + Intronic
1183794895 22:40108612-40108634 CTTTTGCAGTATCACATGTCTGG - Intronic
1184664938 22:45983329-45983351 CTTTTATAATCTTAGATCTAGGG - Intergenic
950635342 3:14310508-14310530 CTTTTAAACTACCAGATCTAAGG + Intergenic
952662574 3:35869490-35869512 CTTATTTAATATCAGATTTAAGG - Intergenic
956221363 3:66907369-66907391 CTTTTGCAATATGAGCTCTCCGG - Intergenic
956824198 3:72982624-72982646 TTTTTTAAATATCAGATTTAAGG + Intronic
957597335 3:82284324-82284346 CTTATGAAAAATCAGATGTAAGG - Intergenic
958096846 3:88956913-88956935 TTTCTGCAAAATCAGATCTCTGG - Intergenic
958620724 3:96555920-96555942 CTTATGCAATATAAGATGTTTGG - Intergenic
958723516 3:97875741-97875763 CTCTTGCAATGTCAGATGTAGGG + Exonic
958778815 3:98517182-98517204 CTTTTTAAAAATCAGATCTTTGG - Exonic
960115551 3:113888795-113888817 TTTTTGCAAGAACAGATCTATGG - Intronic
960450337 3:117799023-117799045 CTCTTGCATTAACAGTTCTAGGG - Intergenic
960819878 3:121718129-121718151 CCTTTGCCATTTTAGATCTAGGG - Intronic
963932538 3:151018681-151018703 CTTTTGCAATATAATATCACAGG + Intergenic
964424903 3:156542086-156542108 CTTTAGCAATATCAGCTAAAAGG - Exonic
964777414 3:160293530-160293552 CTTTTGCCATATGGGATCCATGG + Intronic
964838193 3:160964067-160964089 CATTTGCAATATGATCTCTAAGG - Intronic
965456518 3:168908115-168908137 ATTTTGGAATATCAGAACGAAGG - Intergenic
966218231 3:177524753-177524775 CTTTTGCAGTATCAGATCCGAGG + Intergenic
967528922 3:190527011-190527033 CTTTAGCTATGTCAGATGTATGG - Intronic
967617349 3:191586751-191586773 CTTCTGCAATATCTGATGTATGG + Intergenic
971748870 4:30620277-30620299 CATTTACAATACCAGATTTAAGG + Intergenic
972038313 4:34555384-34555406 AATTTGCAATATCAGATCCCTGG + Intergenic
972262289 4:37421385-37421407 CTTTAGAAATATCAGAACAAAGG - Intronic
977472332 4:97456365-97456387 CTTTTGAAAAACCAGATCTTGGG + Intronic
977613321 4:99059455-99059477 CTTTTGCAATATTAAATCCCAGG - Intronic
978569607 4:110122143-110122165 GTTTTTCTATATCAGATTTAAGG - Intronic
978844535 4:113256552-113256574 CTTATTCAATATCAGAACTGGGG - Intronic
981379118 4:144051438-144051460 CCTTTGCAATGTCAGATAAAAGG + Intergenic
981531459 4:145758348-145758370 CTTGTGCAATAGGAGGTCTAGGG - Intronic
983424066 4:167559637-167559659 TTTTTACAATATCAGGTCTTAGG + Intergenic
984123510 4:175776145-175776167 CTTTTTCAAAAAGAGATCTATGG + Intronic
984203746 4:176760722-176760744 CTTTGGCAATATCACATGCATGG - Intronic
984251044 4:177335181-177335203 CTATTGCAAAATAATATCTATGG - Intronic
986937474 5:12907378-12907400 CTTTTAAACCATCAGATCTAGGG + Intergenic
989257484 5:39381064-39381086 CTTTTGCCATAATAGATCGAAGG - Intronic
990233746 5:53743893-53743915 TTTTTACAGTTTCAGATCTAAGG - Intergenic
993607555 5:90012359-90012381 CTTTTTAAATTTAAGATCTATGG - Intergenic
994448245 5:99905687-99905709 CTTCTACAATTTCAGATATAGGG + Intergenic
994772515 5:104001545-104001567 CTTTTACAATATCAAATCACCGG - Intergenic
998630791 5:143896463-143896485 GTTTTTGAATACCAGATCTAAGG + Intergenic
1000250841 5:159493565-159493587 TTTTTGGAACATCAGTTCTATGG + Intergenic
1000532329 5:162438690-162438712 CTTTCTCTATATCAGATATAAGG - Intergenic
1001909355 5:175502492-175502514 CTTTTGCAAAATTATAACTAAGG - Intronic
1004792370 6:19041034-19041056 CATTTTCAATATCAGATTTTTGG - Intergenic
1005028078 6:21483082-21483104 CTTTTGAAATATCAGTTCTAGGG - Intergenic
1005141744 6:22639814-22639836 CTTTTGAAATCTCATATCTTAGG + Intergenic
1012928557 6:105293030-105293052 CTTTCCCCATATCAGATATAAGG + Intronic
1013876221 6:114832878-114832900 CTTATGCAATATCATGTCCAGGG - Intergenic
1014063745 6:117101983-117102005 CTTTTAGAATAACTGATCTAGGG + Intergenic
1015053148 6:128866288-128866310 CTTTGACAATATCAGAAGTATGG + Intergenic
1017275563 6:152563853-152563875 GTTTTGCAATATTAGATATTTGG - Intronic
1018537902 6:164842046-164842068 ATTTTGAAATATGAGATATATGG + Intergenic
1019821489 7:3246525-3246547 CTTTTCAAATATCTGTTCTAAGG - Intergenic
1020770201 7:12381322-12381344 CATTTGCAAAATCAAATCTGGGG + Intronic
1020825160 7:13017805-13017827 CTTGTGCAATTTCACATATAAGG - Intergenic
1021241829 7:18211716-18211738 CTTTTGCATTCTCAGAGCTTAGG - Intronic
1023187187 7:37544527-37544549 CTTTTCCAATAACAGTTCTTTGG + Intergenic
1023316161 7:38939476-38939498 CTTTTGTAATTTCAGTTCTGGGG + Intergenic
1028829396 7:95310956-95310978 TTTATGCAATAGCAGATCTGTGG - Intronic
1031407416 7:121403356-121403378 CATTTGCCACATCAGATCTATGG + Intergenic
1033820159 7:145125488-145125510 CTATGGCAATATCAGAGCCATGG - Intergenic
1034110801 7:148536030-148536052 ATTTTCCAAAATGAGATCTAGGG + Intergenic
1035540521 8:433037-433059 CTTTTGCAATATCAGATCTATGG + Intronic
1037209523 8:16369608-16369630 CTTTTGCTAAATCAGGGCTAAGG - Intronic
1037280467 8:17236004-17236026 CTTTTGCACCTTCATATCTAGGG + Intronic
1039448812 8:37654730-37654752 CTTTAGAAATATCAGATAAATGG - Intergenic
1041589145 8:59556626-59556648 CTTTTACAATATCACACCTTAGG + Intergenic
1044343824 8:91079556-91079578 CATTTCCAATATGACATCTATGG - Intronic
1051780949 9:20688417-20688439 CATGAGCAATATCAGATGTATGG + Intronic
1055042574 9:71891265-71891287 CTTATGAAATTTCAGAGCTAAGG - Intronic
1055157279 9:73079765-73079787 TTTTTGCAATATAAGAATTAGGG - Intronic
1055281332 9:74677803-74677825 CTTTTGCAATATGAAAGCTGTGG - Intronic
1059840183 9:118206195-118206217 CTATTGCAATCTCAGCTCTTTGG - Intergenic
1061769618 9:132908419-132908441 CTTTTGCAATTACATATCTGTGG - Intronic
1186259851 X:7765712-7765734 CTTTGGTAATATCACATCCACGG - Intergenic
1188015304 X:25101803-25101825 ATTTTGAAATATCAGAACTGAGG + Intergenic
1188527965 X:31106723-31106745 CTTTTGAACCATCAGATCTTGGG + Intronic
1191732347 X:64350852-64350874 ATTTTGCAATGTCAGGTCTGTGG - Intronic
1192830299 X:74744235-74744257 CTTTTGCAATGCCAGATGTGAGG + Exonic
1196549558 X:117006602-117006624 CTTTGAGAATATCAGATCAAAGG - Intergenic
1197235464 X:124057776-124057798 CTGTTTCAATTTCATATCTAAGG - Intronic