ID: 1035541237

View in Genome Browser
Species Human (GRCh38)
Location 8:440064-440086
Sequence GAGTGACCCTGAGCCCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035541236_1035541237 9 Left 1035541236 8:440032-440054 CCTCACAGCAGCGCATGGGAAAG 0: 3
1: 0
2: 3
3: 8
4: 179
Right 1035541237 8:440064-440086 GAGTGACCCTGAGCCCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035541237 Original CRISPR GAGTGACCCTGAGCCCTCCC AGG Intronic
No off target data available for this crispr