ID: 1035544429

View in Genome Browser
Species Human (GRCh38)
Location 8:468613-468635
Sequence CTGCTTGTTGATGTGGACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 123}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035544429_1035544434 12 Left 1035544429 8:468613-468635 CCAGGGTCCACATCAACAAGCAG 0: 1
1: 0
2: 1
3: 21
4: 123
Right 1035544434 8:468648-468670 CAAGCACCATCACTAGAGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 87
1035544429_1035544435 16 Left 1035544429 8:468613-468635 CCAGGGTCCACATCAACAAGCAG 0: 1
1: 0
2: 1
3: 21
4: 123
Right 1035544435 8:468652-468674 CACCATCACTAGAGTGTGGCTGG 0: 1
1: 0
2: 2
3: 10
4: 88
1035544429_1035544440 24 Left 1035544429 8:468613-468635 CCAGGGTCCACATCAACAAGCAG 0: 1
1: 0
2: 1
3: 21
4: 123
Right 1035544440 8:468660-468682 CTAGAGTGTGGCTGGTGGTGGGG 0: 1
1: 0
2: 3
3: 30
4: 320
1035544429_1035544438 22 Left 1035544429 8:468613-468635 CCAGGGTCCACATCAACAAGCAG 0: 1
1: 0
2: 1
3: 21
4: 123
Right 1035544438 8:468658-468680 CACTAGAGTGTGGCTGGTGGTGG 0: 1
1: 0
2: 1
3: 29
4: 420
1035544429_1035544437 19 Left 1035544429 8:468613-468635 CCAGGGTCCACATCAACAAGCAG 0: 1
1: 0
2: 1
3: 21
4: 123
Right 1035544437 8:468655-468677 CATCACTAGAGTGTGGCTGGTGG 0: 1
1: 0
2: 1
3: 15
4: 159
1035544429_1035544439 23 Left 1035544429 8:468613-468635 CCAGGGTCCACATCAACAAGCAG 0: 1
1: 0
2: 1
3: 21
4: 123
Right 1035544439 8:468659-468681 ACTAGAGTGTGGCTGGTGGTGGG 0: 1
1: 0
2: 0
3: 16
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035544429 Original CRISPR CTGCTTGTTGATGTGGACCC TGG (reversed) Intronic
900471708 1:2858231-2858253 CTGATGGTTGATGTGGAAACTGG - Intergenic
901022438 1:6261943-6261965 CTGCTTCTTGATGGGGGCCCTGG + Intergenic
901379326 1:8862520-8862542 CTGTTTGTGGATGTGGAGCCAGG - Intronic
901943848 1:12684987-12685009 CTGATTGTTGAAGAGGAACCTGG - Intergenic
902816447 1:18919133-18919155 CTCCTTGCTGCTGGGGACCCAGG - Intronic
904714012 1:32453197-32453219 CTTCTTGCTGATGTGGATTCCGG - Intergenic
905659263 1:39708902-39708924 CTGGCTGTTGATGTTGACACCGG + Intronic
906697760 1:47836162-47836184 CAGCTTTTTCATGTGAACCCAGG - Intronic
911388915 1:97214056-97214078 CTGCTTGTTGCTGGAAACCCAGG - Intronic
912515348 1:110213338-110213360 CTGCTGCTTGCTGTGGAACCTGG + Intronic
913111588 1:115662037-115662059 CTGCTGGTGGAAGTGGACCGTGG - Intronic
913159040 1:116128868-116128890 TTGCCTGGTGATTTGGACCCTGG - Intronic
915046173 1:153018724-153018746 CTGCTTCTTTAGGTGGAACCTGG + Intergenic
922668938 1:227494591-227494613 GTGCTTGTGGATGTGGAGCCGGG - Intergenic
922670660 1:227506711-227506733 GTGCTTGTGGATGTGGAGCCGGG + Intergenic
1064422553 10:15203238-15203260 CTGCTTCTGGGTGTGGCCCCAGG - Intergenic
1068949040 10:62759182-62759204 CTGTTTGTGGATTTGGAGCCAGG + Intergenic
1069736924 10:70662571-70662593 CTGCTTGTTTATGTGTTCCATGG - Intergenic
1069825842 10:71254542-71254564 CAGCTTATTGATGGGGACCCAGG - Intronic
1069831304 10:71283948-71283970 CTGCTTGCTGCTGTGGCCCAGGG - Intronic
1070106233 10:73434002-73434024 CTGTTTGTTGATCTAGACACAGG + Intergenic
1076104999 10:127814778-127814800 CTGGATGGTGATGTGCACCCAGG + Intergenic
1076196769 10:128524217-128524239 CTGCTTGTTGATGACAATCCTGG - Intergenic
1076924290 10:133474424-133474446 CTGGCTGTTGATGTGAACTCGGG - Intergenic
1077755534 11:5024444-5024466 CTGCTTATTCATGTAGATCCTGG + Intergenic
1078948041 11:16093978-16094000 CTGTTTGCTCATGTGGACTCTGG - Intronic
1083653789 11:64219519-64219541 CAGCTTGTTGATGTGGTACTAGG - Exonic
1084686110 11:70696463-70696485 CTGCCTGTAGAAGTGGACCCTGG - Intronic
1086375052 11:86191567-86191589 CTGCTTGCTGCTGAGGTCCCCGG - Intergenic
1087047341 11:93853027-93853049 CTGCTTACTGCTGTGAACCCTGG + Intergenic
1088017845 11:105081888-105081910 CTGCTTCTTGAGGTGGGACCGGG + Intronic
1088434176 11:109792500-109792522 CTCCTTATTGATCTGGACCCTGG - Intergenic
1092302632 12:7266722-7266744 CTGCATGTTCATATGGTCCCTGG + Intergenic
1093966190 12:25329315-25329337 CTGCTTGTGGATTTTGGCCCTGG + Intergenic
1098477697 12:70924304-70924326 CTGCTTGTGGCAGTGGACTCTGG + Intergenic
1101042416 12:100770233-100770255 GTGCTTGTTCATGTGGACTCGGG + Intronic
1102261024 12:111443349-111443371 CTGCATTTCCATGTGGACCCTGG + Intronic
1102583048 12:113903959-113903981 CAGCTGGTTAATGTGAACCCTGG + Intronic
1105500417 13:20966728-20966750 CTGCTTGTTAATGCTGAGCCAGG - Intergenic
1105501341 13:20975284-20975306 CAGCTTGGTGATGAGGTCCCTGG + Exonic
1106438141 13:29741846-29741868 CTGCTGGTTGATTCTGACCCTGG - Intergenic
1110367940 13:74708671-74708693 GTGGTAGCTGATGTGGACCCAGG - Intergenic
1113863563 13:113506920-113506942 CTGCTTGGTGGTGTAGACTCGGG + Intronic
1114958185 14:27849342-27849364 CTGCTTTTTTAGGTGGAACCTGG + Intergenic
1115012324 14:28564264-28564286 CTGATTGTTGATGTTGGCCTTGG - Intergenic
1119885171 14:78134398-78134420 CTACCTTTTGATGTGGACACAGG + Intergenic
1122513447 14:102288823-102288845 CTGCTTCTTGATCTGGAAGCAGG + Intronic
1122790670 14:104182961-104182983 CTGCTTCTTGCTGGGGAGCCTGG + Intergenic
1125584508 15:40810520-40810542 CTACTTGATTATGTGGGCCCTGG + Intronic
1131087054 15:89585705-89585727 TAGGTTGCTGATGTGGACCCTGG + Exonic
1131253753 15:90847853-90847875 CCGCTTGTTGATCTGGATGCTGG - Intergenic
1131822190 15:96284619-96284641 CTGCTGGTTGATGTTGGCCATGG - Intergenic
1132902262 16:2263594-2263616 CTGCTGGCTGATGCTGACCCAGG + Intronic
1133734084 16:8600797-8600819 CTGCTTGCTGCTGTGGCCACTGG + Intergenic
1134404800 16:13947067-13947089 CTGCTTTTTAATGTGACCCCAGG + Intronic
1139388040 16:66586939-66586961 GTGTTTGTTGATGGGGACCCTGG + Intronic
1141676628 16:85521175-85521197 CTGATACTTGATGTGGTCCCGGG + Intergenic
1141748215 16:85940397-85940419 TTACTCATTGATGTGGACCCAGG - Intergenic
1141868740 16:86769788-86769810 CTGCTTGTGGCTGTGGCTCCTGG - Intergenic
1143088755 17:4436041-4436063 CTGCTGGCTGCTGTGGACCCAGG + Intronic
1145809231 17:27754833-27754855 GTGCGGGTTGATGTGGAACCTGG - Intergenic
1147533769 17:41304245-41304267 CTGGTTGGTGATGCGGAGCCAGG - Intergenic
1148076786 17:44941739-44941761 CTGCTGGGAAATGTGGACCCAGG - Intronic
1152622556 17:81372571-81372593 CGGCTTGGAGATGTGGACTCCGG - Intergenic
1156917662 18:42480665-42480687 CAGCTTTTTGATGTGGACACTGG + Intergenic
1157684530 18:49631710-49631732 CTGCTCCCTGATTTGGACCCTGG + Intergenic
1159387278 18:67742434-67742456 CTGCTTCTTTATGTGGGACCTGG + Intergenic
1160919622 19:1513489-1513511 CTGCTCGTGGATGGGGACCCTGG + Intronic
1162357348 19:10194502-10194524 CTGCTTGAAGAAGGGGACCCCGG + Intronic
1164042110 19:21502362-21502384 TTGGTTGTTCATGGGGACCCTGG + Intronic
1164138727 19:22438455-22438477 TTGGTTGTTCATGGGGACCCTGG + Intronic
1164308608 19:24026913-24026935 TTGGTTGTTCATGGGGACCCTGG - Intergenic
929247327 2:39717093-39717115 CTGCCTGCTGATGTGGAACATGG + Exonic
931081020 2:58770889-58770911 CTGATTGTTGATGAGGACACAGG + Intergenic
937485276 2:122308965-122308987 CTTATTGTTGATGTGGCCACAGG + Intergenic
938369487 2:130760391-130760413 ATGCTTCTTCATGAGGACCCAGG - Intronic
940480870 2:154229020-154229042 GTGCTTGTTGCTGTATACCCGGG + Intronic
940903784 2:159150397-159150419 CTGCTTGTTAGTGTGGAGCAAGG - Exonic
942426732 2:175868084-175868106 CTGCTTATTGAATTGGACCTGGG + Intergenic
946197107 2:218040208-218040230 CCGCTTGGTCATATGGACCCTGG + Intronic
946869747 2:224074934-224074956 CTACTTAATGATGTGGTCCCTGG + Intergenic
947472529 2:230412247-230412269 CTGCGTGATGATGCGGACTCAGG + Intergenic
1172004208 20:31806694-31806716 CAGCTTGGTGGTGTGGATCCAGG + Intergenic
1179708093 21:43194067-43194089 CTGCTTCCTGGTGTGGATCCTGG + Intergenic
1179951122 21:44709257-44709279 CTGCGTGATGCTGCGGACCCAGG - Intronic
1180260970 21:46668373-46668395 CTGCTTGTTGAAGTCTTCCCAGG + Intergenic
1184460170 22:44633372-44633394 CTGCTGGGTGCTGTGGACACAGG - Intergenic
951863630 3:27281797-27281819 CTGCTTGTTGCAGTGTACTCTGG - Intronic
951998309 3:28756117-28756139 CTGCTTTATTATGTGTACCCAGG + Intergenic
952817860 3:37461183-37461205 CTGGTTGTTGCTGTGGAACCAGG - Intronic
956023212 3:64954494-64954516 CTGCTTCTTGATCTGGATGCTGG + Intergenic
959114189 3:102156549-102156571 CAGCTTGTTGAGGTGTATCCAGG + Intronic
960371478 3:116846324-116846346 CTGCTTGTTGATGTGGAGGAGGG + Intronic
964620269 3:158714210-158714232 CTGCTCGCTGATGTGGCCCCAGG - Intronic
967625212 3:191674561-191674583 CTGCTTCTTAATATGTACCCAGG - Intergenic
969880590 4:10170247-10170269 CAACTTCTTGATGTGGCCCCAGG + Intergenic
971135592 4:23864704-23864726 CTTCTTGTTTATGTGCTCCCAGG - Intronic
971969858 4:33606642-33606664 TGGCTTGTTGAAGTCGACCCTGG + Intergenic
976527867 4:86114915-86114937 CTGCTTCTTTAGGTGGAACCTGG - Intronic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
977413802 4:96703404-96703426 CTGATTGTGGAAGTGTACCCAGG + Intergenic
978651104 4:111006233-111006255 CTGTTGGTTTATGTGGACCCTGG + Intergenic
979151545 4:117322759-117322781 CTGCTTGTAGAAGTGGGCACTGG + Intergenic
979482330 4:121234456-121234478 CTGCTTCTTGATGTGGGTGCTGG - Intergenic
982010229 4:151099071-151099093 CTGCTTGTTGATGTGGATGCTGG - Intergenic
982802076 4:159718130-159718152 CTACCTGTTGGTGTGGACTCAGG - Intergenic
988713880 5:33805231-33805253 TGGATTGTTGATGTTGACCCAGG - Intronic
990434021 5:55769385-55769407 TTGCTTGTTGTTGTCAACCCTGG + Intronic
995629451 5:114117572-114117594 CTGCATGCAGATATGGACCCAGG + Intergenic
1001876575 5:175206746-175206768 CTGCTTGTTGAAGGGGAACTGGG + Intergenic
1002680737 5:180961518-180961540 CTGTTTGTGGTGGTGGACCCAGG + Intergenic
1011591441 6:88974111-88974133 CTGCTTGTTGTTTTGCTCCCTGG - Intergenic
1017893792 6:158661305-158661327 CTGCCTGTTCATCTGGAACCTGG + Exonic
1019191561 6:170254021-170254043 CTGCTTGTGGCTGCAGACCCAGG - Intergenic
1022989455 7:35694228-35694250 CTGCTTCTTGAACTGGACCGTGG - Exonic
1024109804 7:46133733-46133755 CTGCTTGTTGTAGTGGCCACAGG - Intergenic
1025114895 7:56249178-56249200 CAGCTTGTTGATGTGGAGCTGGG - Intergenic
1027956525 7:84885895-84885917 CTTCTTGTTGAATTGAACCCTGG + Intergenic
1028103906 7:86854892-86854914 CTGCATGTGGATGTGGCCACTGG - Intronic
1028723354 7:94059096-94059118 TTGCTTGTTCATGTGTATCCAGG - Intergenic
1034784259 7:153910814-153910836 CTGCTTGTTGATGTGGGGATTGG - Intronic
1035081983 7:156224044-156224066 CTGCTTGCTGGTGTGTACCGCGG + Intergenic
1035544429 8:468613-468635 CTGCTTGTTGATGTGGACCCTGG - Intronic
1036127440 8:6075859-6075881 CTGCTTGTGGATGTCGGGCCTGG - Intergenic
1039251394 8:35668808-35668830 CTTCTTGTTGAAATGGAGCCTGG + Intronic
1039489187 8:37935104-37935126 CTGCTCGGTGATGTGACCCCAGG + Exonic
1040947659 8:52901030-52901052 TTTCTTGGTGAAGTGGACCCTGG + Intergenic
1041843760 8:62303047-62303069 CTGGTCATTGTTGTGGACCCTGG + Intronic
1042176079 8:66037953-66037975 CTGCTTGGTGCAGTGGGCCCAGG + Intronic
1051345178 9:16144939-16144961 CTGGAGGTTGATGTGCACCCTGG - Intergenic
1053678715 9:40464863-40464885 CTGCTTTTTTAGGTGGAACCTGG + Intergenic
1054285008 9:63160079-63160101 CTGCTTTTTTAGGTGGAACCTGG - Intergenic
1054291793 9:63300401-63300423 CTGCTTTTTTAGGTGGAACCTGG + Intergenic
1054389811 9:64604944-64604966 CTGCTTTTTTAGGTGGAACCTGG + Intergenic
1054505903 9:65911432-65911454 CTGCTTTTTTAGGTGGAACCTGG - Intergenic
1056684338 9:88747124-88747146 CTGCTTGTTGATTCTGACCCAGG + Intergenic
1057826984 9:98378803-98378825 CTGCTTCTTGATATGGATCCTGG + Intronic
1058938475 9:109791413-109791435 CTGCTTTTCTCTGTGGACCCAGG - Intronic
1061055952 9:128223020-128223042 CAGCTTGGGGAGGTGGACCCGGG + Intronic
1185755689 X:2651304-2651326 CTGATTTTTGAAGTGGTCCCAGG + Intergenic
1188322459 X:28756752-28756774 CTGCTGCATGATGTGTACCCTGG + Intronic
1193818018 X:86126428-86126450 CTGCTTTTTTATGTGGGTCCCGG - Intergenic
1197348262 X:125350497-125350519 CTGCTTGTTATTCAGGACCCAGG - Intergenic
1199461563 X:148091149-148091171 CTGCTTTTTGTGGTGGATCCTGG + Intergenic
1200234234 X:154460458-154460480 CAGCTTGTTGATGTTGTCCACGG - Exonic
1200730019 Y:6724643-6724665 CTCCTGGTTGAAGTGGACCAGGG + Intergenic