ID: 1035549046

View in Genome Browser
Species Human (GRCh38)
Location 8:506069-506091
Sequence CCACTGCCACAAAGACAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035549036_1035549046 13 Left 1035549036 8:506033-506055 CCTCTTTCTCCTCACCCATTCAG 0: 1
1: 1
2: 5
3: 59
4: 570
Right 1035549046 8:506069-506091 CCACTGCCACAAAGACAGAGGGG No data
1035549039_1035549046 -1 Left 1035549039 8:506047-506069 CCCATTCAGCCATGGCCGCTTTC 0: 1
1: 0
2: 1
3: 3
4: 97
Right 1035549046 8:506069-506091 CCACTGCCACAAAGACAGAGGGG No data
1035549040_1035549046 -2 Left 1035549040 8:506048-506070 CCATTCAGCCATGGCCGCTTTCC 0: 1
1: 0
2: 1
3: 8
4: 117
Right 1035549046 8:506069-506091 CCACTGCCACAAAGACAGAGGGG No data
1035549041_1035549046 -10 Left 1035549041 8:506056-506078 CCATGGCCGCTTTCCACTGCCAC 0: 1
1: 0
2: 1
3: 8
4: 188
Right 1035549046 8:506069-506091 CCACTGCCACAAAGACAGAGGGG No data
1035549038_1035549046 4 Left 1035549038 8:506042-506064 CCTCACCCATTCAGCCATGGCCG 0: 1
1: 0
2: 0
3: 17
4: 124
Right 1035549046 8:506069-506091 CCACTGCCACAAAGACAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035549046 Original CRISPR CCACTGCCACAAAGACAGAG GGG Intronic
No off target data available for this crispr