ID: 1035552818

View in Genome Browser
Species Human (GRCh38)
Location 8:543653-543675
Sequence CATTCCTAACTCATGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 248}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035552818 Original CRISPR CATTCCTAACTCATGGAAAA TGG (reversed) Intronic
902509224 1:16956705-16956727 CATTTTTAAATCATCGAAAATGG - Intronic
902554250 1:17237651-17237673 CATTCCTGACTATTGGATAAGGG - Intronic
903980735 1:27186122-27186144 CATTTCCAAACCATGGAAAAAGG - Intergenic
904770861 1:32880730-32880752 CATTCCTGGGTCATGGCAAAGGG - Intergenic
905747988 1:40435757-40435779 AATTCCTGACTCATGGAAACTGG + Intergenic
905816690 1:40956470-40956492 CAGTCCTAACTAATAGAAATAGG - Intergenic
907002155 1:50872199-50872221 CATTCATAATTCATGGGAAGAGG + Intronic
909232604 1:73109197-73109219 CATGCCTAACTCATTGAAAGCGG + Intergenic
909844140 1:80369280-80369302 CATTCATTACTCATGGAAAGAGG + Intergenic
911944128 1:104084396-104084418 CATTCCCAACACCTGGAGAAAGG - Intergenic
912954224 1:114142224-114142246 CATTCATAATTCAGGGGAAAAGG + Intronic
913041623 1:115031774-115031796 AATTCCTTACTCATGGAATCTGG - Intronic
913454523 1:119017690-119017712 CATTCCTAACTCATGCTTATTGG + Intergenic
914028268 1:143932721-143932743 CATTACTAACTGAAGAAAAATGG - Intergenic
914253027 1:145937507-145937529 AATTCCTAACTCATTGATACTGG - Intronic
922032572 1:221816182-221816204 CATTCATAATTCATGGGAAGAGG + Intergenic
922959082 1:229630140-229630162 TATTCCTGAATCATGGAAAGAGG - Intronic
923312149 1:232745507-232745529 CATTTCTAACACATGTAAAGTGG - Intergenic
924821861 1:247500383-247500405 CATTACTAACTGAAGAAAAATGG - Intergenic
1064635608 10:17363328-17363350 TATGCGTTACTCATGGAAAAAGG - Intronic
1065410303 10:25419591-25419613 CCTTCCAAACTGGTGGAAAATGG - Intronic
1066094873 10:32062509-32062531 CATTCTTAACTCCTGGAAACTGG + Intergenic
1066460231 10:35606836-35606858 CATTCCTAATAACTGGAAAAGGG + Intronic
1068919644 10:62469406-62469428 CATTACTAACTGAAGTAAAATGG - Intronic
1074210979 10:111334891-111334913 CACAACTAACTCATGAAAAATGG - Intergenic
1074661972 10:115669952-115669974 CATTTCTAAATCAAAGAAAAGGG - Intronic
1075628872 10:123987496-123987518 CATTATTAACTAAAGGAAAATGG - Intergenic
1075686130 10:124366603-124366625 CATTCCTAATTCAAGGAGCAGGG + Intergenic
1079175292 11:18134734-18134756 CATTCCAGTCTTATGGAAAAAGG + Intronic
1081410682 11:42754436-42754458 CATTTGTGACTCATGGGAAAAGG + Intergenic
1082219835 11:49621275-49621297 GATTCGTAAAGCATGGAAAAAGG - Intergenic
1082632968 11:55562310-55562332 CTTTCCCAACTCAGGGCAAATGG + Intergenic
1085438009 11:76527422-76527444 CCTTCTTAACTCTTGGAAATGGG + Intronic
1086629797 11:89003502-89003524 GATTCTTAAAGCATGGAAAAAGG + Intronic
1090033411 11:123227447-123227469 CATTCCTAAGTCACTGATAAAGG - Intergenic
1090374759 11:126280883-126280905 CATTCCAATCTCAGGGCAAAAGG + Intergenic
1091288012 11:134419535-134419557 CAGAACTAACTCATGGAAATCGG - Intergenic
1091831911 12:3556088-3556110 CAAACCTAACACATGCAAAAAGG - Intronic
1092714273 12:11372262-11372284 CATTATTAACTGAAGGAAAATGG + Intronic
1095277868 12:40310818-40310840 CATTTCTAATTCATAGAAATGGG + Intronic
1096453529 12:51766243-51766265 CTTTCCTAACTCTAGGAAAAGGG - Intronic
1097420396 12:59371435-59371457 AATTGCATACTCATGGAAAAGGG + Intergenic
1099077343 12:78127029-78127051 AATGCTTAACTCATTGAAAAAGG - Intronic
1100313838 12:93424756-93424778 ATTACCTAACCCATGGAAAATGG + Intronic
1101262240 12:103045016-103045038 CATTCCTAACTGATTGAATCAGG - Intergenic
1101453520 12:104805376-104805398 CATTCCTAGCCCATGAAACATGG + Intronic
1104073874 12:125372591-125372613 CAATCCTAACTAGTGCAAAATGG - Intronic
1104208483 12:126663639-126663661 CATTTTTATCTCATGAAAAATGG - Intergenic
1105307111 13:19176806-19176828 CATGCCTAGCCCATGGAATAGGG + Intronic
1105586140 13:21744697-21744719 CTTCCTTGACTCATGGAAAATGG + Intergenic
1105912692 13:24885771-24885793 CATCCTTAACTAATGGATAAAGG - Intronic
1106301178 13:28467332-28467354 CATTACTCACTCAGGGAAATGGG - Intronic
1109084166 13:57949252-57949274 TATTCCTAACTCATTCAATAGGG - Intergenic
1109287924 13:60433915-60433937 CTTTCCTTACTGATGGTAAAGGG + Intronic
1109776198 13:67044005-67044027 AATTCCTAATTCAAGGAAAGAGG + Intronic
1110772602 13:79366866-79366888 TATTCCTTCCTCATAGAAAAGGG - Exonic
1111239006 13:85450581-85450603 CATTAATAAATCATGAAAAAAGG - Intergenic
1112221444 13:97495273-97495295 CATTCCTAACTGATGCAGCAGGG + Intergenic
1113007667 13:105725674-105725696 GAGTCATGACTCATGGAAAATGG - Intergenic
1113122604 13:106940604-106940626 CTTTCCTAACTGATGAGAAAGGG - Intergenic
1113607142 13:111617271-111617293 CAGTCCTAGCTCAGGGAGAAAGG + Intronic
1114368694 14:22060037-22060059 CATTTGTAACTCATGGAAGTAGG + Intergenic
1114977426 14:28119273-28119295 CATTCATGATTCATGGAAGAAGG + Intergenic
1115438823 14:33408403-33408425 CATGCCATACACATGGAAAAGGG + Intronic
1116391790 14:44400654-44400676 CATTTGTATTTCATGGAAAAGGG + Intergenic
1116473607 14:45314252-45314274 CATTCTCAACTCATGTTAAAAGG - Intergenic
1117066509 14:52017206-52017228 CATGCCTAACTCCTGGGAAATGG + Intronic
1117475826 14:56094099-56094121 CATTTCTATCTCATGGAAGCTGG + Intergenic
1117679228 14:58186062-58186084 ACTTCGTAACTGATGGAAAATGG + Intronic
1117737842 14:58785809-58785831 CATTTCTAACTCTTGGAAGAGGG - Intergenic
1120497185 14:85252209-85252231 CATTCATAACTCATTCATAAAGG - Intergenic
1124696448 15:31868422-31868444 CATTGCAAACTCTTTGAAAATGG - Intronic
1125514871 15:40312865-40312887 GATTCCTAAAGCCTGGAAAAAGG + Intergenic
1130917003 15:88313021-88313043 CATTCTTATCCCAAGGAAAATGG - Intergenic
1134363907 16:13558833-13558855 CATTCCTAGCTTAGGGGAAACGG - Intergenic
1134811994 16:17175622-17175644 CTGTCCTCTCTCATGGAAAATGG + Intronic
1135113338 16:19707554-19707576 CTTTCCTAACTCATGGCACACGG + Intronic
1138836107 16:60436794-60436816 CATTCATAATTCATGGAAAGAGG + Intergenic
1139618520 16:68116863-68116885 CATTCTTAAGTAAAGGAAAAAGG + Intronic
1140249398 16:73282200-73282222 CATTGCTTACTGATGGAAAAGGG - Intergenic
1141265411 16:82492375-82492397 CATTCCTAACTCATTGGAGGAGG + Intergenic
1141873140 16:86803370-86803392 CATTTCTAACTTAAGAAAAAAGG + Intergenic
1143354893 17:6319599-6319621 CAATCCTTACTCAAGGAAAGTGG + Intergenic
1145098535 17:20053468-20053490 CCTTTCTAACTAATGGAATAAGG + Intronic
1145277627 17:21443317-21443339 CATTCATGATTCATGGAAGAAGG - Intergenic
1145315463 17:21729199-21729221 CATTCATGATTCATGGAAGAAGG - Intergenic
1146773258 17:35587971-35587993 CATTCCTTACTCTTGGAGGAAGG + Intronic
1147626406 17:41903420-41903442 CATTCCAATCTTTTGGAAAAAGG + Intronic
1149062574 17:52440393-52440415 CATTCCTAACTCATTCAATGAGG + Intergenic
1151252505 17:72847448-72847470 TATTCATAACTCAAAGAAAAGGG + Intronic
1152278788 17:79373142-79373164 CATTTGTAACACATGGAAATGGG - Intronic
1153126603 18:1799729-1799751 CATTCATGATTCATGGGAAAAGG + Intergenic
1153672956 18:7429889-7429911 TATTCATAATTCCTGGAAAAGGG - Intergenic
1154341763 18:13508982-13509004 CATTCATGACTCATGAGAAAAGG + Intronic
1159727878 18:71985253-71985275 CATTATTAACTGATGAAAAATGG - Intergenic
1159787252 18:72728841-72728863 CTTTCATAACTCAAGGAAATGGG - Intergenic
1159844140 18:73438480-73438502 CATTCCTCAACCATTGAAAAGGG + Intergenic
1162184626 19:8895270-8895292 CATTCTTAAAGCATGGAAACAGG + Intronic
1166116574 19:40659221-40659243 CATTCTTAACTGAAGAAAAATGG + Intergenic
1167023344 19:46895603-46895625 CATTTCTAATTGATGGGAAATGG - Intergenic
1167219817 19:48191570-48191592 CATTCTGATCACATGGAAAAGGG + Intronic
924980192 2:212412-212434 CATTCATGACTCATGGGAAGAGG - Intergenic
929650529 2:43676319-43676341 CTGTCCTAACGCCTGGAAAATGG - Intronic
929784972 2:44982959-44982981 CAGTCCTAACTCATGTAGTAAGG - Intergenic
930491935 2:52084967-52084989 CATTCATGATTCATGGAAGAAGG - Intergenic
930624749 2:53684415-53684437 AATTCCTAATTCATGAATAAAGG + Intronic
930712726 2:54564365-54564387 CACTCCTCATTCTTGGAAAAAGG + Intronic
931963057 2:67503146-67503168 GATTCCTTTCTCATGAAAAAAGG + Intergenic
932401497 2:71483682-71483704 CGTGCCTAACTGATGGGAAAAGG - Intronic
933306501 2:80606604-80606626 AACTCCTAAATCATGGAAATAGG - Intronic
937479550 2:122244103-122244125 CAATCCTAGCTCCTGGAAGAAGG - Intergenic
938298495 2:130193672-130193694 CATGCCTAGCCCATGGAACAGGG + Intronic
938458237 2:131480841-131480863 CATGCCTAGCCCATGGAACAGGG - Intronic
939563294 2:143756691-143756713 CATTCATATCTCATTGTAAATGG - Intronic
939686078 2:145202443-145202465 TATTCAGAACTCATTGAAAAGGG - Intergenic
940777541 2:157900577-157900599 AATTCCAAACTCCTGGGAAAGGG + Intronic
940778264 2:157906655-157906677 GAGTCCTAACTCTTGGAGAATGG + Intronic
942542177 2:177025883-177025905 CATTCCTGACTCTAGGAAGATGG - Intergenic
943404490 2:187462426-187462448 AATTCATAACTAATGCAAAAAGG - Intergenic
943479290 2:188397317-188397339 CATTCCTAACTTTTGGAATCTGG + Intronic
943572764 2:189593451-189593473 CATTCCTAACTGATATAACAAGG - Intergenic
943734327 2:191337502-191337524 TATTCCTCACTAATGGACAAAGG - Intronic
944104285 2:196062744-196062766 CATTGCTAATTCAAGGAAGAAGG - Intronic
945126277 2:206514283-206514305 CATTCCTAATTAATGGAAGGAGG + Intronic
945832633 2:214805459-214805481 CATTCAAAACTCATGAAGAAAGG + Intronic
946442813 2:219711199-219711221 CTTTCCTAGCTTCTGGAAAAAGG + Intergenic
948369139 2:237476184-237476206 CATTCCTAACTGATTGAATGAGG - Intergenic
1170418289 20:16167843-16167865 CATTGCTACCTCATGGATACCGG - Intergenic
1170758645 20:19229326-19229348 CTTTACTGACTCAGGGAAAAGGG - Intronic
1173009155 20:39165615-39165637 CATTCCTAACTCATTGCTGATGG + Intergenic
1173504272 20:43574713-43574735 CATCCCCAACCCATGGCAAAGGG + Intronic
1173628960 20:44495630-44495652 AAATACTGACTCATGGAAAAGGG - Intergenic
1174608348 20:51778051-51778073 CATTCGTAATTCATGGGAGAAGG - Intergenic
1175154761 20:56963016-56963038 TATTTCTAACTCATAGAAACTGG + Intergenic
1179621300 21:42617885-42617907 CATCCCTATCTCAGGAAAAATGG - Intergenic
1181286921 22:21759059-21759081 CATTCCTGACTCTAGGAAGAAGG - Exonic
1184783527 22:46660790-46660812 CCTTCCTAACTCTTGGGAAGCGG - Intronic
951203739 3:19903422-19903444 TATTTCTAACCCATTGAAAATGG + Intronic
951912157 3:27762046-27762068 CATTCATAACTCATGGGCACAGG + Intergenic
955815210 3:62834973-62834995 TCTTCCAAACCCATGGAAAATGG - Intronic
955947330 3:64207979-64208001 CATTGGAAACTCAGGGAAAATGG - Intronic
957562713 3:81844062-81844084 GTTTCCTAACTGCTGGAAAAGGG + Intergenic
958492893 3:94800377-94800399 CATTCATAATTCATGGGAGAAGG - Intergenic
958530001 3:95315811-95315833 CATTCATTATTCATGGGAAAAGG - Intergenic
958590212 3:96148230-96148252 TATTGCAAACTCAAGGAAAAAGG - Intergenic
958615585 3:96490093-96490115 CCTTCCTAACTCATTGTAAGAGG - Intergenic
959036350 3:101369764-101369786 CAAGCCTGTCTCATGGAAAAAGG + Intronic
964469223 3:157034341-157034363 CATTCCTAATTCATGGGTAGAGG + Intronic
965190207 3:165518097-165518119 CATTCCAAATTCCTGGAAATTGG - Intergenic
966683969 3:182673639-182673661 CATTCTTCACTCCTGCAAAATGG - Intergenic
970567354 4:17345686-17345708 CACTCCAAATTCATGGCAAAAGG + Intergenic
970891641 4:21052186-21052208 AATTCCAAACGCTTGGAAAATGG - Intronic
971977782 4:33712689-33712711 CATTTGTAATTCATAGAAAAAGG - Intergenic
972154566 4:36143250-36143272 AATTCCTACCTAATTGAAAATGG - Intronic
972427890 4:38951942-38951964 CATTTCCATCTCATTGAAAAAGG + Intergenic
973164132 4:47055661-47055683 TTTTCCTAACTCATGGCAAATGG - Intronic
974913506 4:68150871-68150893 AATTCCTAACCCAAGGCAAATGG + Intergenic
975003343 4:69254498-69254520 CATTCAGAAATTATGGAAAATGG + Intergenic
975011624 4:69361864-69361886 CATTCAGAAATTATGGAAAATGG + Intronic
975246202 4:72123397-72123419 CCTCCCTAACTCATGGAATGAGG + Intronic
975780343 4:77832563-77832585 GGTTCTTAACTCATGGATAAGGG - Intergenic
976220617 4:82754152-82754174 CCTTCTTAACTCCTGCAAAACGG - Intronic
977188419 4:93969927-93969949 GATTCCTAACTCATGGACGCTGG + Intergenic
978425046 4:108573337-108573359 TTTTCCAAACACATGGAAAATGG + Intergenic
978960649 4:114673825-114673847 AATTTCTAACTGATGGCAAAAGG - Intronic
979852246 4:125587630-125587652 CATTCAGAACTCATTGAAACGGG - Intergenic
984177576 4:176438117-176438139 CATGCCAAACCCATGGAAACTGG - Intergenic
985168370 4:187122251-187122273 CTTTCCTAACACAATGAAAATGG + Intergenic
985554276 5:548691-548713 CATTGCCAACCCATGGGAAATGG - Intergenic
987124596 5:14799994-14800016 CATTCCTGACTCATGGGAGGAGG + Intronic
987773875 5:22339101-22339123 GACTCCTAACCCATTGAAAATGG + Intronic
987982317 5:25101917-25101939 CATTCATCATTTATGGAAAAAGG - Intergenic
988207719 5:28161666-28161688 TATTTCTCACTCATGTAAAATGG - Intergenic
988270771 5:29013641-29013663 CATGGATAACTCATGGCAAAAGG - Intergenic
988873951 5:35423154-35423176 CATTCATAACTCTATGAAAAGGG + Intergenic
990591956 5:57275230-57275252 GTTTTCTAACTCATGAAAAAAGG - Intergenic
990677218 5:58201050-58201072 CATTCATAATTCATGGAAAGAGG + Intergenic
993184808 5:84603858-84603880 AATTCCTTACTAAGGGAAAAAGG - Intergenic
993344870 5:86770255-86770277 CATTCCCAACACAGGGTAAAAGG + Intergenic
993632516 5:90303142-90303164 CATTCCTAAAATAAGGAAAATGG - Intergenic
993641859 5:90415651-90415673 CAGTCAAAACTCATGGAAACTGG - Intergenic
993844361 5:92922199-92922221 AACTCCTAACTCCTGGAAAATGG + Intergenic
994140948 5:96340438-96340460 AATTACTAACTCATTAAAAACGG - Intergenic
994449411 5:99922790-99922812 CATTCCTAAATAATGGACAATGG - Intergenic
995627712 5:114097452-114097474 CATTCCTACCTCATGGATTATGG + Intergenic
998265956 5:140668062-140668084 CATTTCAAACTCACTGAAAATGG + Intronic
998278013 5:140776882-140776904 CATTATTAACTGAAGGAAAATGG + Intergenic
998673368 5:144379004-144379026 CATTTACAACTCATGGAGAAAGG + Intronic
998791226 5:145767724-145767746 CCTTCATAAGTCATGGAAAGGGG + Intronic
999575941 5:152977069-152977091 CATTCATGATTCATGGAAAGAGG + Intergenic
999789304 5:154923684-154923706 CATTCTTAATTCATGGACCATGG + Intronic
1001541388 5:172542360-172542382 CTTTCCTCATTCATGGAACAAGG + Intergenic
1002848150 6:967308-967330 ACTTACTAACTCGTGGAAAAAGG + Intergenic
1002985202 6:2183268-2183290 GATTCATGATTCATGGAAAAGGG + Intronic
1003835562 6:10069085-10069107 CATTTCTACCTCATTGAAGAGGG - Intronic
1003989807 6:11474416-11474438 CTTTCCTACCTCCAGGAAAAAGG - Intergenic
1004966791 6:20861086-20861108 CAGTCCTGACTCATGAAACATGG - Intronic
1008114929 6:47538150-47538172 CATTCATCATTCATGTAAAATGG + Intronic
1008358379 6:50584600-50584622 ACATCCTAACTCATTGAAAATGG + Intergenic
1010147597 6:72689383-72689405 CATCCCTAACTCATCCAAAGTGG + Intronic
1010393311 6:75361205-75361227 TATTCCTAACTCAGGGACAGAGG - Intronic
1010438478 6:75863843-75863865 CAGTCCACCCTCATGGAAAATGG - Intronic
1011245319 6:85315897-85315919 CATTCCTGACACAAGTAAAAAGG + Intergenic
1011541972 6:88440585-88440607 GATTTTTAACTCATGAAAAATGG + Intergenic
1013428764 6:110037658-110037680 CATGCCAAATGCATGGAAAAGGG + Intergenic
1015297812 6:131618457-131618479 CATTTGTAATTCATGGAAACTGG - Exonic
1015838763 6:137452985-137453007 CATTATGAACTCATGGATAACGG - Intergenic
1017799674 6:157882576-157882598 CATTCATGATTCATGGAAGAAGG + Intronic
1018438242 6:163782689-163782711 CAGTCCTGTCTCAGGGAAAAGGG + Intergenic
1018642841 6:165920797-165920819 AATCCCTAACCCATGGAATATGG - Intronic
1020741201 7:12020878-12020900 CATTTCTAAATTATGGGAAAAGG - Intergenic
1020944642 7:14587144-14587166 CATTCATAATTCATGGACAGAGG + Intronic
1022766214 7:33415313-33415335 CTTTCCAAACTCAAGGAATATGG - Intronic
1023292731 7:38685487-38685509 CATCCATAATTCATGGATAATGG - Exonic
1023355163 7:39359509-39359531 CCTTCCTAATTTATGGAAATAGG + Intronic
1032625673 7:133589182-133589204 CATTACTAACTGAAGAAAAATGG + Intronic
1032879621 7:136075275-136075297 CATTCTTATCTCAGGTAAAATGG - Intergenic
1033686397 7:143644800-143644822 CATGCCTAGCACATAGAAAAGGG - Intronic
1033689341 7:143722515-143722537 CATGCCTAGCACATAGAAAAGGG + Intronic
1033698216 7:143812821-143812843 CATGCCTAGCACATAGAAAAGGG + Intergenic
1035552818 8:543653-543675 CATTCCTAACTCATGGAAAATGG - Intronic
1035931108 8:3781326-3781348 CATTCTTTACTCATTGAACACGG + Intronic
1038941124 8:32307138-32307160 CATTGATAAATCATGGCAAAAGG + Intronic
1041366195 8:57107852-57107874 CATTCCTGACCCATAGAAACAGG - Intergenic
1043610179 8:82053288-82053310 CATTAATGACTCATGGCAAAAGG + Intergenic
1045792865 8:106005988-106006010 CAGAAGTAACTCATGGAAAAAGG + Intergenic
1045883710 8:107071066-107071088 TTTTCCAAACTCATGTAAAAAGG - Intergenic
1046026370 8:108729129-108729151 CATTCCTTACTGAAGGCAAAGGG + Intronic
1046744021 8:117857863-117857885 CATTCATAATTCATGGGAGAAGG + Intronic
1047536892 8:125728224-125728246 CATTCCTAACTGATGTAAGAAGG + Intergenic
1047847533 8:128824532-128824554 CATGCCACACTCATGGCAAAAGG - Intergenic
1047873643 8:129111898-129111920 GATTCCTAAGGCATGTAAAAAGG + Intergenic
1048641915 8:136372865-136372887 CCTTTATAACTCATTGAAAATGG + Intergenic
1051389959 9:16553164-16553186 AATTCCTAACTCATGCCATATGG + Intronic
1052380118 9:27761302-27761324 CACTCTTCAATCATGGAAAATGG + Intergenic
1056056034 9:82824854-82824876 AATTCTGAGCTCATGGAAAATGG + Intergenic
1056595705 9:88006478-88006500 GTTTCCAAAATCATGGAAAAAGG + Intergenic
1056757428 9:89390614-89390636 CATTCGTCTCTCATGGAAATTGG - Intronic
1057279187 9:93698146-93698168 CATCCCTTACTCAGGGAACATGG - Intergenic
1058346856 9:103974130-103974152 TATTCCTAACTCACAGAAACTGG + Intergenic
1058564329 9:106265647-106265669 CATTCTTAACTAATGGGAATGGG - Intergenic
1059268101 9:113054905-113054927 CATGGCTACCTCATGGAAGACGG - Intronic
1060053902 9:120396949-120396971 CATTCCTACCTCTGGAAAAAGGG + Intronic
1060403416 9:123361230-123361252 CACTCATAACCCATGGTAAAGGG - Intronic
1060960140 9:127674960-127674982 CCTTCCTCACTCATGAAACATGG + Intronic
1061363791 9:130159870-130159892 CATTCCCCACTCAGGGCAAATGG - Intergenic
1185894477 X:3845146-3845168 AATTACTAACTCCAGGAAAAAGG + Intergenic
1185899595 X:3883570-3883592 AATTACTAACTCCAGGAAAAAGG + Intergenic
1185904711 X:3921999-3922021 AATTACTAACTCCAGGAAAAAGG + Intergenic
1186542903 X:10419128-10419150 CATTTCTAACCAATGGAATACGG + Intergenic
1187689055 X:21845985-21846007 CATCCATGACTCATGGAAATGGG - Intronic
1188448389 X:30281926-30281948 CATTCATAACTCATGAAGAAAGG + Intergenic
1188697013 X:33206440-33206462 CATTCCTCACTAATGGGAACTGG - Intronic
1189028505 X:37425719-37425741 CATTGCTGACTCACGGAAAGAGG + Intronic
1189563936 X:42219929-42219951 TAATCCTAACTGATGGCAAAAGG - Intergenic
1190034960 X:47013615-47013637 CATTATTAACTGAAGGAAAATGG + Intronic
1190073203 X:47295681-47295703 CATGCCCACCTCATGGAAACTGG - Intergenic
1190871436 X:54427807-54427829 GATTTCTAACCCATGGAAACTGG + Intergenic
1192635015 X:72807977-72807999 CATCCCTCACCCATGGAAGAGGG - Intronic
1192646700 X:72912826-72912848 CATCCCTCACCCATGGAAGAGGG + Intronic
1193971473 X:88060254-88060276 AATTCCTCAGCCATGGAAAATGG + Intergenic
1195418850 X:104650897-104650919 CATTAATAAATTATGGAAAAAGG - Intronic
1195428216 X:104759744-104759766 AATACTCAACTCATGGAAAATGG + Intronic
1197474066 X:126897943-126897965 CATTCAGAACTCATGGGAGAAGG + Intergenic
1198886710 X:141346584-141346606 CATTCCTAGTTCCTGAAAAACGG + Intergenic
1200366328 X:155668861-155668883 CAATTCTAAATCATGGAACAGGG - Intronic