ID: 1035553010

View in Genome Browser
Species Human (GRCh38)
Location 8:544644-544666
Sequence CCTCACCTGCGCCTGGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 403}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035552990_1035553010 27 Left 1035552990 8:544594-544616 CCCTCCACCTGCGCGCCCCCGGC 0: 1
1: 0
2: 0
3: 36
4: 315
Right 1035553010 8:544644-544666 CCTCACCTGCGCCTGGGCGGCGG 0: 1
1: 0
2: 5
3: 28
4: 403
1035553001_1035553010 -9 Left 1035553001 8:544630-544652 CCACCTGCGCACCCCCTCACCTG 0: 1
1: 0
2: 5
3: 59
4: 610
Right 1035553010 8:544644-544666 CCTCACCTGCGCCTGGGCGGCGG 0: 1
1: 0
2: 5
3: 28
4: 403
1035552992_1035553010 23 Left 1035552992 8:544598-544620 CCACCTGCGCGCCCCCGGCCTAC 0: 1
1: 0
2: 1
3: 16
4: 295
Right 1035553010 8:544644-544666 CCTCACCTGCGCCTGGGCGGCGG 0: 1
1: 0
2: 5
3: 28
4: 403
1035552993_1035553010 20 Left 1035552993 8:544601-544623 CCTGCGCGCCCCCGGCCTACTAG 0: 1
1: 0
2: 0
3: 8
4: 61
Right 1035553010 8:544644-544666 CCTCACCTGCGCCTGGGCGGCGG 0: 1
1: 0
2: 5
3: 28
4: 403
1035552999_1035553010 -7 Left 1035552999 8:544628-544650 CCCCACCTGCGCACCCCCTCACC 0: 1
1: 1
2: 15
3: 152
4: 892
Right 1035553010 8:544644-544666 CCTCACCTGCGCCTGGGCGGCGG 0: 1
1: 0
2: 5
3: 28
4: 403
1035552997_1035553010 9 Left 1035552997 8:544612-544634 CCGGCCTACTAGCACTCCCCACC 0: 1
1: 0
2: 0
3: 10
4: 184
Right 1035553010 8:544644-544666 CCTCACCTGCGCCTGGGCGGCGG 0: 1
1: 0
2: 5
3: 28
4: 403
1035553000_1035553010 -8 Left 1035553000 8:544629-544651 CCCACCTGCGCACCCCCTCACCT 0: 1
1: 0
2: 4
3: 43
4: 472
Right 1035553010 8:544644-544666 CCTCACCTGCGCCTGGGCGGCGG 0: 1
1: 0
2: 5
3: 28
4: 403
1035552994_1035553010 12 Left 1035552994 8:544609-544631 CCCCCGGCCTACTAGCACTCCCC 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1035553010 8:544644-544666 CCTCACCTGCGCCTGGGCGGCGG 0: 1
1: 0
2: 5
3: 28
4: 403
1035552998_1035553010 5 Left 1035552998 8:544616-544638 CCTACTAGCACTCCCCACCTGCG 0: 1
1: 0
2: 2
3: 8
4: 115
Right 1035553010 8:544644-544666 CCTCACCTGCGCCTGGGCGGCGG 0: 1
1: 0
2: 5
3: 28
4: 403
1035552991_1035553010 26 Left 1035552991 8:544595-544617 CCTCCACCTGCGCGCCCCCGGCC 0: 1
1: 0
2: 2
3: 78
4: 645
Right 1035553010 8:544644-544666 CCTCACCTGCGCCTGGGCGGCGG 0: 1
1: 0
2: 5
3: 28
4: 403
1035552996_1035553010 10 Left 1035552996 8:544611-544633 CCCGGCCTACTAGCACTCCCCAC 0: 1
1: 0
2: 1
3: 17
4: 308
Right 1035553010 8:544644-544666 CCTCACCTGCGCCTGGGCGGCGG 0: 1
1: 0
2: 5
3: 28
4: 403
1035552995_1035553010 11 Left 1035552995 8:544610-544632 CCCCGGCCTACTAGCACTCCCCA 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1035553010 8:544644-544666 CCTCACCTGCGCCTGGGCGGCGG 0: 1
1: 0
2: 5
3: 28
4: 403

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035553010 Original CRISPR CCTCACCTGCGCCTGGGCGG CGG Exonic