ID: 1035553198

View in Genome Browser
Species Human (GRCh38)
Location 8:545163-545185
Sequence GAAGGGCGAGGGTCTCGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035553198_1035553205 9 Left 1035553198 8:545163-545185 CCCCGGCGAGACCCTCGCCCTTC 0: 1
1: 0
2: 0
3: 7
4: 90
Right 1035553205 8:545195-545217 CTGAACGACGTCCTCACCCCAGG No data
1035553198_1035553208 25 Left 1035553198 8:545163-545185 CCCCGGCGAGACCCTCGCCCTTC 0: 1
1: 0
2: 0
3: 7
4: 90
Right 1035553208 8:545211-545233 CCCCAGGCTACCCCGTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035553198 Original CRISPR GAAGGGCGAGGGTCTCGCCG GGG (reversed) Intronic
900652126 1:3734868-3734890 GAAGGGCCAGGCCCTCGCCCTGG - Exonic
900661582 1:3787106-3787128 GAAGGGCAAGGGCCGTGCCGAGG - Exonic
901631276 1:10649351-10649373 GAAGGGCGAGGGCTCCGCAGCGG + Exonic
908572177 1:65421005-65421027 GGAGGGCGCCGCTCTCGCCGAGG - Intronic
911547186 1:99232328-99232350 GAAGGGCAAGGGCCTCTCCAGGG + Intergenic
916939267 1:169662857-169662879 GATGGGCGAGAGTCTCGCTTGGG - Intronic
1074165635 10:110871920-110871942 GAAGGGCCAGAGACTCTCCGAGG + Exonic
1076544845 10:131238387-131238409 GCAGGGCGGGGGTCTCCCCACGG + Intronic
1077027960 11:450110-450132 GGATGGCGCGGGTCTCGCCAAGG - Intronic
1084113826 11:67030438-67030460 GCAGGATGAGGGTCTCCCCGGGG - Intronic
1084801265 11:71545722-71545744 GAATGGCCAGGGCCTCTCCGTGG - Intronic
1090425841 11:126606607-126606629 GAATGTCGAGGGTCTCGGCCTGG - Intronic
1090619464 11:128548670-128548692 GAAGGGCGAGGTTCGGGCCGAGG + Intronic
1091140985 11:133234490-133234512 GAATGGCCAGGGTCTTGCAGAGG + Intronic
1093301778 12:17467656-17467678 AAAGGGCAAGGGTCTCTCTGTGG - Intergenic
1095997988 12:48105754-48105776 GCAGGGAGACGGTCTCTCCGCGG + Exonic
1096241301 12:49961686-49961708 GGGGGGCGGGGGTCGCGCCGGGG + Intergenic
1102036148 12:109771539-109771561 GAAGGGCCTGGGTCCCGCCCTGG - Intergenic
1102235424 12:111291495-111291517 GAAGTGTGGAGGTCTCGCCGGGG - Exonic
1104873966 12:132020076-132020098 GAAGCCCGAGGGTCGCACCGTGG + Exonic
1113958246 13:114110888-114110910 GCAGAGTGAGGGTCTGGCCGTGG + Intronic
1116817647 14:49598804-49598826 GCAGGGCCGGGTTCTCGCCGTGG - Exonic
1117978677 14:61321595-61321617 GCGGTGCGAGGTTCTCGCCGGGG + Intronic
1118260056 14:64238208-64238230 GAAGGCCCAGGGTCTGGCCTTGG - Intronic
1122249157 14:100425910-100425932 CAAGGCCCAGGGTCTCGCCCTGG - Intronic
1125921731 15:43529163-43529185 GATGGGCGGGGGTCTGGCTGTGG - Exonic
1130032917 15:80332329-80332351 GAAGGGTGAGGGTGGCTCCGTGG + Intergenic
1132407519 15:101552733-101552755 GGAGAGCAAGGGTCCCGCCGGGG - Intergenic
1132527928 16:426564-426586 GAAGGGGGTGGGTCTGGCTGAGG - Exonic
1132686307 16:1163539-1163561 GAGGGGCGAGGGTCTCTCTCAGG + Intronic
1132803832 16:1766683-1766705 GATGGGCGAGGGGCTCACCCAGG - Intronic
1133333481 16:4990967-4990989 GAAGGGTAAGGGTCTTGCCAGGG - Intronic
1136858691 16:33681585-33681607 GAAGTGGGAGCGTCTTGCCGGGG - Intergenic
1138528110 16:57620436-57620458 GCAGGGCAAGGGTGACGCCGCGG + Intronic
1203120264 16_KI270728v1_random:1530078-1530100 GAAGTGGGAGCGTCTCGCCGGGG - Intergenic
1142637645 17:1268149-1268171 GAAACGCCAGGGTCTCGCCTGGG + Intergenic
1143550461 17:7627478-7627500 GCAGGGGGAGGGGCTCGCCTTGG - Intronic
1146415030 17:32623843-32623865 AAAGGGCGAGGGTCTCTCTGGGG + Intronic
1151319051 17:73341943-73341965 GAAGGGTGAGGGTTTTGCTGGGG + Intronic
1151363053 17:73600149-73600171 GAAGGGTGAGGGTCTGCCCCGGG - Intronic
1157234593 18:45952508-45952530 GAAGGGCCAGGGTCTGGTGGAGG + Exonic
1157576938 18:48749918-48749940 GAAGGGCGAGGGCCTTCCCCTGG + Intronic
1161681181 19:5680633-5680655 GAAGGGCTGCGGTCTCGCAGCGG + Exonic
1165412913 19:35673348-35673370 GAGGGGCGAGGGTCCCGGCGCGG + Intronic
1168658849 19:58150580-58150602 CTAGGGCGAGGGTCTGGCCAGGG - Intronic
925284530 2:2707060-2707082 GAAGGGCCAGGGTCCCCTCGAGG - Intergenic
927667353 2:25041988-25042010 GCGGGGCGAGGGGCTCGCAGAGG + Intergenic
932143386 2:69298560-69298582 GAAGGGCCAGGGTTTCTCCTTGG - Intergenic
932791062 2:74654661-74654683 GAAGTGCGAAGATCTCGCCCCGG - Intronic
933895612 2:86807834-86807856 GAAGGGCGGGGGGCTAGCCCAGG + Intronic
934728132 2:96638200-96638222 GACGGCCGGGGGTCTCGGCGAGG - Intronic
936954934 2:118013953-118013975 GGAGGGCCAGGGTCTCCCGGAGG - Exonic
944070168 2:195658188-195658210 GAAGGGCGGGGGCCTTGCCAGGG + Intronic
1179906627 21:44426247-44426269 GGAGGGCGGGGGTCTCCCAGGGG - Intronic
1183488686 22:38105160-38105182 GAAGGGCCAGAGTCCCGCCAGGG + Intronic
1184956375 22:47889479-47889501 GAAGGGGGAGGGTCTCTCTCAGG + Intergenic
1185019736 22:48367158-48367180 GAAGGAGGAGGGTCTCTCTGAGG + Intergenic
1185314705 22:50174063-50174085 GAAGGGCCAGGGCCTGGCCTCGG + Intronic
950465245 3:13149519-13149541 GAGGGGAGAGGGTGTCCCCGGGG + Intergenic
950479233 3:13234476-13234498 GAAGGGAGGGGGTCTCCCAGGGG - Intergenic
952287261 3:31981084-31981106 GGAGGGCGAGGAGCCCGCCGAGG + Exonic
952367309 3:32685959-32685981 GACGGGCGGGGGTCTCGCTATGG + Intronic
953033078 3:39190635-39190657 GAGGGGCGGGGGTGTAGCCGGGG - Intronic
962400841 3:135057462-135057484 GAAGGGCCAGGGTCTCTGCTGGG + Intronic
964358603 3:155871420-155871442 GAATGGAGCGGGCCTCGCCGAGG - Intronic
968705050 4:2073802-2073824 GCAGAGCGAGGGTCTCCCTGGGG + Intronic
972482032 4:39506045-39506067 GTAGAGACAGGGTCTCGCCGTGG - Intronic
986257816 5:6115345-6115367 AAAGGGTGAGGGTCTCTCTGGGG - Intergenic
986649203 5:9947063-9947085 GAAGGACCAGGGCCTCGCCTAGG - Intergenic
990286953 5:54310181-54310203 GCAGGGCGAGGGTCGCGCTGGGG - Intronic
996567259 5:124892741-124892763 GCAGGGCTAGGCTCTGGCCGGGG - Intergenic
1001652648 5:173327048-173327070 GGTGGGCGAGGGTCTCGGGGTGG + Intronic
1002448712 5:179307125-179307147 GCAGGGCGAGGGTCTGGGCCGGG - Intronic
1006302143 6:33199356-33199378 GAAGGGGGAGGGACTCCCTGGGG + Exonic
1011607331 6:89117982-89118004 GAGGGGTGGGGGTCGCGCCGGGG - Exonic
1018452911 6:163925520-163925542 GAGGGGTGAGGGTCTCTCCTGGG - Intergenic
1020418145 7:7969221-7969243 GAGGGGCGGGGGTATCGCTGTGG - Exonic
1029074860 7:97927678-97927700 GAAGGGAGAGGTTCTGGTCGGGG - Intergenic
1031535343 7:122927186-122927208 AAAGGGTGAGGGTCTTGCTGAGG + Intergenic
1035242115 7:157538880-157538902 TAAGGGCCAGGGTGTCGCTGAGG - Intergenic
1035553198 8:545163-545185 GAAGGGCGAGGGTCTCGCCGGGG - Intronic
1036658420 8:10692283-10692305 GAAGGGCCAAGGCCTCGGCGGGG - Intronic
1041108910 8:54467339-54467361 GAAGGGCGAGGCGCCGGCCGGGG + Intergenic
1043457348 8:80425832-80425854 GAAGAGAGAGGGTCTCACCCTGG - Intergenic
1047145355 8:122192678-122192700 GAAGGGTGAGGGTTTCTCCGGGG + Intergenic
1049283644 8:141763050-141763072 GAGGGGCGAGGCTCACACCGAGG + Intergenic
1049338535 8:142099524-142099546 GAAGGGTGAGGGTGACGCCCAGG - Intergenic
1049879362 8:145051907-145051929 GAAGAGCGAGGGTCAGGGCGCGG - Intergenic
1054762318 9:69014107-69014129 CAGGGGCGGGGGTCTCGCGGCGG + Exonic
1055650094 9:78398619-78398641 CAGGGGCCAGGGTCTCGCCATGG - Intergenic
1057499503 9:95585509-95585531 GAAGGGCGAGTGTCTGGCAAAGG - Intergenic
1059102451 9:111483701-111483723 GAAGGGCGACGCTCGCGACGCGG - Intronic
1061347855 9:130042089-130042111 GAAAGGCGAGGGGCTGGCTGTGG - Intronic
1062432635 9:136532842-136532864 GAAGGGGGAAGGTCTCGTGGGGG + Intronic
1185505524 X:630328-630350 GAAGCGCCCGGGTCGCGCCGGGG - Intronic
1195364468 X:104113247-104113269 GTAGGGCGAGGGTCTCCCGGAGG + Intronic
1197758551 X:130012764-130012786 GAAGGGACAGGGTCTCTCCCAGG + Intronic
1200054222 X:153450356-153450378 AACAGGCTAGGGTCTCGCCGGGG + Intronic