ID: 1035556242

View in Genome Browser
Species Human (GRCh38)
Location 8:569297-569319
Sequence CCGAATATGCAAACAGACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035556242_1035556252 20 Left 1035556242 8:569297-569319 CCCTTGTCTGTTTGCATATTCGG No data
Right 1035556252 8:569340-569362 GGCGTGCCCTGTCTCAGGCCTGG No data
1035556242_1035556247 -3 Left 1035556242 8:569297-569319 CCCTTGTCTGTTTGCATATTCGG No data
Right 1035556247 8:569317-569339 CGGTCTTCCGTCTAGGAGCAGGG No data
1035556242_1035556249 -1 Left 1035556242 8:569297-569319 CCCTTGTCTGTTTGCATATTCGG No data
Right 1035556249 8:569319-569341 GTCTTCCGTCTAGGAGCAGGGGG No data
1035556242_1035556251 15 Left 1035556242 8:569297-569319 CCCTTGTCTGTTTGCATATTCGG No data
Right 1035556251 8:569335-569357 CAGGGGGCGTGCCCTGTCTCAGG No data
1035556242_1035556246 -4 Left 1035556242 8:569297-569319 CCCTTGTCTGTTTGCATATTCGG No data
Right 1035556246 8:569316-569338 TCGGTCTTCCGTCTAGGAGCAGG No data
1035556242_1035556248 -2 Left 1035556242 8:569297-569319 CCCTTGTCTGTTTGCATATTCGG No data
Right 1035556248 8:569318-569340 GGTCTTCCGTCTAGGAGCAGGGG No data
1035556242_1035556245 -10 Left 1035556242 8:569297-569319 CCCTTGTCTGTTTGCATATTCGG No data
Right 1035556245 8:569310-569332 GCATATTCGGTCTTCCGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035556242 Original CRISPR CCGAATATGCAAACAGACAA GGG (reversed) Intergenic
No off target data available for this crispr