ID: 1035556317

View in Genome Browser
Species Human (GRCh38)
Location 8:569658-569680
Sequence CAGAAGCCTACATTATTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035556314_1035556317 21 Left 1035556314 8:569614-569636 CCACACTCTTGGAATCTGGGCAC No data
Right 1035556317 8:569658-569680 CAGAAGCCTACATTATTTTAAGG No data
1035556311_1035556317 30 Left 1035556311 8:569605-569627 CCATTATCTCCACACTCTTGGAA No data
Right 1035556317 8:569658-569680 CAGAAGCCTACATTATTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035556317 Original CRISPR CAGAAGCCTACATTATTTTA AGG Intergenic
No off target data available for this crispr