ID: 1035557521

View in Genome Browser
Species Human (GRCh38)
Location 8:577988-578010
Sequence CTCACCCCTGCTGCATGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035557521_1035557526 22 Left 1035557521 8:577988-578010 CCACCTCATGCAGCAGGGGTGAG No data
Right 1035557526 8:578033-578055 AGAATCGTCTGCAACCTTGCAGG No data
1035557521_1035557528 24 Left 1035557521 8:577988-578010 CCACCTCATGCAGCAGGGGTGAG No data
Right 1035557528 8:578035-578057 AATCGTCTGCAACCTTGCAGGGG No data
1035557521_1035557527 23 Left 1035557521 8:577988-578010 CCACCTCATGCAGCAGGGGTGAG No data
Right 1035557527 8:578034-578056 GAATCGTCTGCAACCTTGCAGGG No data
1035557521_1035557523 -3 Left 1035557521 8:577988-578010 CCACCTCATGCAGCAGGGGTGAG No data
Right 1035557523 8:578008-578030 GAGTTGTCTCCCGTAGTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035557521 Original CRISPR CTCACCCCTGCTGCATGAGG TGG (reversed) Intergenic
No off target data available for this crispr