ID: 1035557981

View in Genome Browser
Species Human (GRCh38)
Location 8:580479-580501
Sequence CCCACCCAGAACCTCCGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035557970_1035557981 21 Left 1035557970 8:580435-580457 CCGAGGCCCATCCGGATCAACCA No data
Right 1035557981 8:580479-580501 CCCACCCAGAACCTCCGCAAAGG No data
1035557977_1035557981 -6 Left 1035557977 8:580462-580484 CCTTTCCTCTCCAGGCACCCACC No data
Right 1035557981 8:580479-580501 CCCACCCAGAACCTCCGCAAAGG No data
1035557973_1035557981 14 Left 1035557973 8:580442-580464 CCATCCGGATCAACCAGGCTCCT No data
Right 1035557981 8:580479-580501 CCCACCCAGAACCTCCGCAAAGG No data
1035557974_1035557981 10 Left 1035557974 8:580446-580468 CCGGATCAACCAGGCTCCTTTCC No data
Right 1035557981 8:580479-580501 CCCACCCAGAACCTCCGCAAAGG No data
1035557976_1035557981 1 Left 1035557976 8:580455-580477 CCAGGCTCCTTTCCTCTCCAGGC No data
Right 1035557981 8:580479-580501 CCCACCCAGAACCTCCGCAAAGG No data
1035557969_1035557981 22 Left 1035557969 8:580434-580456 CCCGAGGCCCATCCGGATCAACC No data
Right 1035557981 8:580479-580501 CCCACCCAGAACCTCCGCAAAGG No data
1035557972_1035557981 15 Left 1035557972 8:580441-580463 CCCATCCGGATCAACCAGGCTCC No data
Right 1035557981 8:580479-580501 CCCACCCAGAACCTCCGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035557981 Original CRISPR CCCACCCAGAACCTCCGCAA AGG Intergenic
No off target data available for this crispr