ID: 1035558703

View in Genome Browser
Species Human (GRCh38)
Location 8:588703-588725
Sequence CTGATTGGTGTACCTGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035558703_1035558709 17 Left 1035558703 8:588703-588725 CCCATCCCAGGTACACCAATCAG No data
Right 1035558709 8:588743-588765 TCACATAGTCCCGTATTTCTTGG 0: 121
1: 6340
2: 2708
3: 1123
4: 908
1035558703_1035558710 20 Left 1035558703 8:588703-588725 CCCATCCCAGGTACACCAATCAG No data
Right 1035558710 8:588746-588768 CATAGTCCCGTATTTCTTGGAGG 0: 128
1: 6243
2: 2778
3: 1450
4: 1408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035558703 Original CRISPR CTGATTGGTGTACCTGGGAT GGG (reversed) Intergenic
No off target data available for this crispr