ID: 1035560848

View in Genome Browser
Species Human (GRCh38)
Location 8:602530-602552
Sequence AGGGAGCCCCAAGACCAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035560845_1035560848 -7 Left 1035560845 8:602514-602536 CCTCCGACGGGGGACAAGGGAGC No data
Right 1035560848 8:602530-602552 AGGGAGCCCCAAGACCAAGGAGG No data
1035560846_1035560848 -10 Left 1035560846 8:602517-602539 CCGACGGGGGACAAGGGAGCCCC No data
Right 1035560848 8:602530-602552 AGGGAGCCCCAAGACCAAGGAGG No data
1035560840_1035560848 4 Left 1035560840 8:602503-602525 CCTGACTCTGACCTCCGACGGGG No data
Right 1035560848 8:602530-602552 AGGGAGCCCCAAGACCAAGGAGG No data
1035560838_1035560848 5 Left 1035560838 8:602502-602524 CCCTGACTCTGACCTCCGACGGG No data
Right 1035560848 8:602530-602552 AGGGAGCCCCAAGACCAAGGAGG No data
1035560835_1035560848 19 Left 1035560835 8:602488-602510 CCCTGGTTAAGAAACCCTGACTC No data
Right 1035560848 8:602530-602552 AGGGAGCCCCAAGACCAAGGAGG No data
1035560836_1035560848 18 Left 1035560836 8:602489-602511 CCTGGTTAAGAAACCCTGACTCT No data
Right 1035560848 8:602530-602552 AGGGAGCCCCAAGACCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035560848 Original CRISPR AGGGAGCCCCAAGACCAAGG AGG Intergenic