ID: 1035563674

View in Genome Browser
Species Human (GRCh38)
Location 8:627629-627651
Sequence GGCACCCCGGACCTCCGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 337}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035563674_1035563679 7 Left 1035563674 8:627629-627651 CCTTCACGGAGGTCCGGGGTGCC 0: 1
1: 0
2: 0
3: 6
4: 337
Right 1035563679 8:627659-627681 ACCACCTGAACCCGAAAGCAAGG No data
1035563674_1035563682 14 Left 1035563674 8:627629-627651 CCTTCACGGAGGTCCGGGGTGCC 0: 1
1: 0
2: 0
3: 6
4: 337
Right 1035563682 8:627666-627688 GAACCCGAAAGCAAGGCCACAGG No data
1035563674_1035563683 15 Left 1035563674 8:627629-627651 CCTTCACGGAGGTCCGGGGTGCC 0: 1
1: 0
2: 0
3: 6
4: 337
Right 1035563683 8:627667-627689 AACCCGAAAGCAAGGCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035563674 Original CRISPR GGCACCCCGGACCTCCGTGA AGG (reversed) Intronic
902019005 1:13329233-13329255 GGCACCCCTCACCTCCCGGACGG - Intergenic
903426547 1:23257837-23257859 GGCACCCCTCACCTCCCGGACGG - Intergenic
903993222 1:27288936-27288958 GGCACCCCTCACCTCCCGGACGG + Intronic
904077522 1:27853326-27853348 GGCACCCCTCACCTCCCAGACGG - Intergenic
906370386 1:45248282-45248304 GGCACCCCCCACCTCCTGGACGG - Intronic
906400018 1:45497789-45497811 GGCACCCCTCACCTCCCGGATGG - Intronic
906742045 1:48192734-48192756 GGCACCCCTCACCTCCCGGACGG - Intergenic
907909750 1:58815497-58815519 GGCTCCCCGGCCCTGCGAGAGGG - Intergenic
911533938 1:99078547-99078569 GGCGCCCCCGACCTCCCGGACGG + Intergenic
912266125 1:108160051-108160073 GGCACCCCTCACCTCCCGGATGG + Intronic
912825159 1:112898387-112898409 GGCGCCCCTCACCTCCCTGACGG + Intergenic
913078375 1:115360233-115360255 GGCACTCCTGACCTCCCAGACGG + Intergenic
913078438 1:115360439-115360461 GGCACCCCTCACCTCCCAGATGG + Intergenic
914231060 1:145764830-145764852 GGCACCCCCCACCTCCCGGACGG - Intronic
914385604 1:147166901-147166923 GCCATCCTGGACCTCCCTGAGGG - Exonic
915113920 1:153583177-153583199 GGCGCCCCGCACCTCCCGGACGG - Intergenic
915113973 1:153583305-153583327 GGCACCCCTCACCTCCCGGACGG - Intergenic
915264647 1:154708078-154708100 GACACCCCGGGCCTCGATGATGG + Exonic
915410929 1:155700776-155700798 GGCACCCCTCACCTCCCAGACGG - Intronic
916037408 1:160933522-160933544 GGCACCCCCCACCTCCCGGACGG - Intergenic
916131606 1:161616544-161616566 GGCACCCCCCACCTCCCGGACGG + Intronic
916320566 1:163499254-163499276 GGCACCCCTCACCTCCCAGACGG + Intergenic
916792466 1:168136567-168136589 GACAGCCCTGACCTCCGAGAGGG + Intronic
917583085 1:176396688-176396710 GGCACCCCTCACCTCCCGGACGG + Intergenic
917859963 1:179135681-179135703 GGCACCCCTCACCTCCCGGATGG - Intronic
917889035 1:179418575-179418597 GGCACCCCTCACCTCCCGGACGG + Intronic
919129698 1:193437478-193437500 GGCACCCCCTACCTCCTGGACGG + Intergenic
920451732 1:206064685-206064707 GGCACCCCTCACCTCCCGGATGG - Intronic
921044103 1:211460894-211460916 GGCACCCCTCACCTCCCGGACGG - Intergenic
922644954 1:227276522-227276544 GGCGCCCCGCACCTCCCGGACGG - Intronic
922730578 1:227947051-227947073 GGCATCCCAGACCTCAGAGAGGG + Intronic
923468211 1:234267590-234267612 GGCACCCCTCACCTCCTGGATGG + Intronic
1063822685 10:9855663-9855685 GGCACCCCCCACCTCCCAGACGG + Intergenic
1065336396 10:24657332-24657354 GGCACCCCTCACCTCCCGGACGG - Intronic
1065594232 10:27296273-27296295 GGCACCCCTCACCTCCCGGATGG + Intergenic
1067331946 10:45330666-45330688 GGCACCCCTCACCTCCCGGATGG + Intergenic
1067339881 10:45392116-45392138 GGCACCCCTCACCTCCCGGACGG - Intronic
1069052567 10:63811360-63811382 GGCACCCCTCACCTCCCGGACGG + Intergenic
1069365850 10:67692148-67692170 GGCACCCCTCACCTCCCAGAGGG - Intronic
1069698943 10:70407813-70407835 GGCACCCCTCACCTCCCAGATGG + Intronic
1071000701 10:80827842-80827864 GGGACCCTGGACCTCCCTGATGG + Intergenic
1072480908 10:95809492-95809514 GGCACCCCCCACCTCCCAGACGG + Intronic
1073386177 10:103129155-103129177 GGCACCCCTCACCTCCCGGACGG - Intronic
1074588137 10:114787611-114787633 GGCACCCCTCACCTCCCGGACGG - Intergenic
1075061603 10:119260991-119261013 GGCACCCCTCACCTCCCGGACGG + Intronic
1075407218 10:122203245-122203267 GGCACCCCTCACCTCCCGGACGG + Intronic
1076687495 10:132204648-132204670 TGCACCCCGGGCCTCAGGGATGG + Intronic
1079330591 11:19529658-19529680 GGAACCCTGGACCTCTGTGCTGG - Intronic
1080620935 11:33986409-33986431 GGCACCCCTCACCTCCCGGACGG - Intergenic
1080860323 11:36145287-36145309 GGCACCCCTCACCTCCCGGATGG - Intronic
1082166338 11:48955461-48955483 GGCACCCCCCACCTCCCAGACGG + Intergenic
1083091010 11:60200876-60200898 GGCACCCCTCACCTCCCGGACGG + Intergenic
1083208205 11:61166343-61166365 GGCACCCCTCACCTCCCGGACGG + Intergenic
1083291761 11:61694470-61694492 GGCACCCCGGCCCTCTGCTATGG - Intronic
1083739692 11:64702035-64702057 GGCACCCCTCACCTCCCGGACGG - Intronic
1083832175 11:65239711-65239733 GGCACCCCTCACCTCCCAGACGG - Intergenic
1084645861 11:70457177-70457199 GGCACCCCTCACCTCCCAGACGG + Intergenic
1085097893 11:73775371-73775393 GGCACCCCCCACCTCCCGGACGG - Intergenic
1085563251 11:77490362-77490384 GGCACCCCTCACCTCCCGGACGG - Intergenic
1086341537 11:85853070-85853092 GGCGCCCCCGACCTCCCGGACGG - Intergenic
1086447002 11:86879579-86879601 GGCGCCCCTCACCTCCCTGACGG - Intronic
1086697336 11:89861007-89861029 GGCGCCCCTCACCTCCGGGACGG - Intergenic
1086708823 11:89983480-89983502 GGCGCCCCTCACCTCCGGGACGG + Intergenic
1087198177 11:95320942-95320964 GGCACCCCTCACCTCCCGGACGG + Intergenic
1088598152 11:111455144-111455166 GGGAGCCTGGACCTCAGTGAGGG - Intronic
1089264708 11:117251200-117251222 GGCGCCCCGCACCTCCCGGACGG + Intronic
1095439841 12:42228513-42228535 GGCACCCCTCACCTCCCGGACGG - Intronic
1096092975 12:48915734-48915756 GGCACCCCTCACCTCCCGGATGG + Intronic
1096708385 12:53437699-53437721 GGCACCCCCCACCTCCCGGACGG - Intergenic
1097127066 12:56783774-56783796 GGCACCCCTCACCTCCCGGACGG + Intronic
1097128048 12:56789642-56789664 GGCACCCCTCACCTCCCGGACGG + Intergenic
1097149238 12:56963932-56963954 GGCACCCCTCACCTCCCAGATGG - Intergenic
1097301366 12:58022870-58022892 GGGACCCTGGAGCTTCGTGAGGG - Intergenic
1098883930 12:75942264-75942286 GGCACCCCTCACCTCCCGGACGG - Intergenic
1099255205 12:80307393-80307415 GGCACCCCTCACCTCCCGGACGG + Intronic
1099255259 12:80307521-80307543 GGCGCCCCTCACCTCCGGGACGG + Intronic
1100507524 12:95235625-95235647 GGCACCCCTCACCTCCCGGATGG + Intronic
1100995147 12:100294654-100294676 GGCACCCCTCACCTCCCGGACGG + Intronic
1102174568 12:110866904-110866926 GGCGCCCCTCACCTCCGGGACGG + Intronic
1102174646 12:110867080-110867102 GGCACCCCTCACCTCCCAGACGG + Intronic
1102174826 12:110867483-110867505 GGCGCCCCTCACCTCCGGGATGG + Intronic
1102186121 12:110950530-110950552 GGCGCCCCTCACCTCCGGGACGG + Intergenic
1103234381 12:119360119-119360141 GGCACCCCTCACCTCCCGGACGG + Intronic
1103350089 12:120278136-120278158 GGCGCCCCCCACCTCCCTGATGG + Intergenic
1103535994 12:121634276-121634298 GGCGCCCCGCACCTCCCGGACGG + Intronic
1104712743 12:130997093-130997115 GGCACCCCTCACCTCCTGGACGG + Intronic
1104861415 12:131926321-131926343 GGCGCCCCTCACCTCCCTGACGG + Intergenic
1106104815 13:26724048-26724070 GGCGCCCCTCACCTCCCTGACGG - Intergenic
1106114563 13:26806255-26806277 GGCGCCCCGCACCTCCCGGATGG + Intergenic
1106560141 13:30839686-30839708 GGCGCCCCTCACCTCCGGGATGG + Intergenic
1106746985 13:32716874-32716896 GGCACCCCTCACCTCCCGGACGG - Intronic
1108370446 13:49762274-49762296 GGCACCCCCCACCTCCCGGACGG - Intronic
1108608661 13:52064082-52064104 GGCACCCCTCACCTCCCGGATGG - Intronic
1110269627 13:73575488-73575510 GGCACCCCTCACCTCCCGGACGG - Intergenic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1113940111 13:114014610-114014632 GGCACCCAGCTCCTCCCTGAGGG + Intronic
1115703608 14:35977545-35977567 GGCACCCCTCACCTCCCGGACGG + Intergenic
1116191521 14:41673529-41673551 GGCACCCCTCACCTCCCGGACGG + Intronic
1116480609 14:45389802-45389824 GGCACCCCTCACCTCCTGGACGG - Intergenic
1116841223 14:49821492-49821514 GGCACCCCTCACCTCCTGGACGG - Intronic
1117763630 14:59058838-59058860 GGCACCCCTCACCTCCCGGACGG + Intergenic
1121142749 14:91557246-91557268 GGCACCCCTCACCTCCCGGACGG + Intergenic
1121142826 14:91557423-91557445 GGCACCCCTCACCTCCCGGACGG + Intergenic
1121226276 14:92323812-92323834 GGCACCCAGGCGCTCCGGGATGG + Exonic
1122960720 14:105092691-105092713 GGCACCACGGGCCTCTGGGAGGG - Intergenic
1125566852 15:40683529-40683551 GGCGCCCCTGACCTCCCGGACGG - Intergenic
1128970315 15:72101148-72101170 GGCACCCCTCACCTCCCAGACGG - Intronic
1129656601 15:77528955-77528977 GGCCCCCAGGGCCTCCTTGATGG + Intergenic
1130428250 15:83822083-83822105 GGCACCCCTCACCTCCCGGACGG + Intronic
1130656355 15:85794547-85794569 GGCACCCCGCGGCTCCGCGAGGG - Intronic
1131096081 15:89655155-89655177 GGCATCCCGGGCCTGCGTGGAGG - Intronic
1131479293 15:92768233-92768255 GGCACCCCTCACCTCCCGGACGG + Intronic
1133680465 16:8115331-8115353 GGCGCCCCTCACCTCCCTGAGGG - Intergenic
1134215959 16:12317133-12317155 GGCACCCAGGACCTTGGAGAAGG + Intronic
1136572305 16:31104838-31104860 GGCACCCCTCACCTCCCGGACGG - Intergenic
1137284058 16:47000699-47000721 GGCACCCCTCACCTCCCGGACGG - Intergenic
1137388119 16:48059292-48059314 GGCACCCCTCACCTCCCAGACGG + Intergenic
1137522933 16:49210242-49210264 GGCACCCCTCACCTCCCGGACGG + Intergenic
1138400237 16:56739479-56739501 GGCACCCCTCACCTCCCGGACGG + Intronic
1139885657 16:70205232-70205254 GGCACCCCTCACCTCCCAGACGG - Intergenic
1139885712 16:70205362-70205384 GGCACCCCTCACCTCCCGGACGG - Intergenic
1140994349 16:80243913-80243935 GGCACCCCTCACCTCCCGGACGG - Intergenic
1141728724 16:85808198-85808220 GGCACCCCTCACCTCCCGGACGG + Intergenic
1142825484 17:2507408-2507430 GGCACCCCTCACCTCCCGGATGG - Intronic
1144585158 17:16483223-16483245 GGCAGCTCGGGCCTCTGTGAGGG + Intronic
1144649364 17:16997736-16997758 GGCACCCCTGACCTAGGTGCTGG + Intergenic
1144717113 17:17442846-17442868 GGCACCCCTCACCTCCCGGACGG + Intergenic
1147690781 17:42313139-42313161 GGCACCCCTTACCTCCGGGCTGG + Intergenic
1148632955 17:49125908-49125930 GGCACCCCTCACCTCCCAGACGG - Intergenic
1149344531 17:55721035-55721057 GGCTCCCAGGATCTCCTTGATGG + Exonic
1150403011 17:64874506-64874528 GGCACCCCCCACCTCCCGGACGG - Intronic
1151843778 17:76636680-76636702 GGCGCCCCCGACCTCCCAGACGG - Intronic
1152244233 17:79176967-79176989 AGCAGCTGGGACCTCCGTGAAGG - Intronic
1152873870 17:82774634-82774656 GGCACCCCCCACCTCCCAGACGG + Intronic
1154115292 18:11608829-11608851 GGCACCCCGCACCTCCCGGACGG - Intergenic
1154278308 18:12980167-12980189 GGCACCCCTCACCTCCCGGATGG + Intronic
1154289886 18:13098230-13098252 GGCACCCCTCACCTCCCGGACGG + Intronic
1154440187 18:14382761-14382783 GGCACCCCTCACCTCCCGGACGG + Intergenic
1157391944 18:47310275-47310297 GGAACCCTGGGCCTCAGTGATGG - Intergenic
1157677166 18:49577603-49577625 GGCACCCCTCACCTCCCGGACGG + Intronic
1160824835 19:1074714-1074736 GGCACCACGCACCTGCATGAAGG - Exonic
1162887063 19:13703807-13703829 GGCACCCCTCACCTCCCAGACGG - Intergenic
1163258135 19:16170209-16170231 GGCACCCCTAACCTCCCTGGGGG + Intronic
1163906412 19:20152617-20152639 GGCACCCCCCACCTCCCGGACGG + Intergenic
1163945272 19:20529945-20529967 GGCACCCCTCACCTCCCGGATGG + Intergenic
1164192536 19:22927137-22927159 GGCACCCCTCACCTCCCAGACGG - Intergenic
1164659205 19:29948924-29948946 GGCACCCCCCACCTCCCAGACGG + Intronic
1166029894 19:40118269-40118291 GGCACCCCTCACCTCCCGGACGG - Intergenic
1166114910 19:40648080-40648102 GGCGCCCCTGACCTCCCGGACGG + Intergenic
1166162766 19:40965822-40965844 GGCACCCCTCACCTCCCGGACGG + Intergenic
1166162918 19:40966173-40966195 GGCACCCCTCACCTCCCGGACGG + Intergenic
1166162994 19:40966348-40966370 GGCACCCCTCACCTCCTGGACGG + Intergenic
1167528996 19:50003150-50003172 GGCACCCTGGAGCTCAGTGGTGG - Intronic
1168696064 19:58405126-58405148 GGCGCCCCGCACCTCCCGGACGG + Intronic
926252718 2:11165117-11165139 GGCACCCCCCACCTCCCGGACGG + Intronic
926674800 2:15611646-15611668 GGCACCCCCCACCTCCCGGACGG + Intronic
927833029 2:26370444-26370466 GGCACCCCTCACCTCCCGGACGG + Intronic
927897748 2:26795412-26795434 GGCACCCCTCACCTCCCGGACGG + Intronic
928278486 2:29922743-29922765 GGCCCCCAGGAGCTCAGTGAGGG - Intergenic
928541951 2:32293676-32293698 GGCACCCCTCACCTCCCGGAAGG + Intronic
928722130 2:34133099-34133121 GGCGCCCCCCACCTCCCTGATGG + Intergenic
930396267 2:50828191-50828213 GGCACCCCTCACCTCCCGGACGG + Intronic
930396282 2:50828228-50828250 GGCACCCCTCACCTCCCGGACGG + Intronic
930703965 2:54486002-54486024 GGCGCCCCTCACCTCCGGGACGG - Intronic
931783470 2:65600541-65600563 GGCACCCCTCACCTCCCGGATGG + Intergenic
931783592 2:65600814-65600836 GGCACCCCTCACCTCCCGGATGG + Intergenic
932367374 2:71161488-71161510 GGCACCCCTCACCTCCCGGACGG - Intergenic
934703549 2:96461833-96461855 GGCACCCCTCACCTCCCGGACGG - Intergenic
937916775 2:127103121-127103143 GTCACCCAGGCCCTCAGTGATGG - Intronic
938006046 2:127788606-127788628 GGCACCCCTCACCTCCCGGACGG + Intronic
938253444 2:129833722-129833744 GGCACCCCCCACCTCCTGGACGG - Intergenic
938836277 2:135106126-135106148 GGCACCCCCCACCTCCTGGACGG - Intronic
938836295 2:135106166-135106188 GGCACCCCCCACCTCCCGGACGG - Intronic
940269574 2:151875754-151875776 GGCACCCCTCACCTCCCGGACGG + Intronic
940269647 2:151875929-151875951 GGCACCCCTCACCTCCCGGACGG + Intronic
940299246 2:152160730-152160752 GGCACCCCTCACCTCCCGGATGG - Intronic
942630267 2:177945908-177945930 GGCACCCCTCACCTCCCGGACGG - Intronic
943411857 2:187557016-187557038 GGCACCCCTCACCTCCCGGACGG - Intronic
943411931 2:187557192-187557214 GGCACCCCTCACCTCCCGGACGG - Intronic
943773613 2:191742495-191742517 GGCACCCCTCACCTCCCGGACGG - Intergenic
944625409 2:201563548-201563570 GGCACCCCTCACCTCCTGGACGG + Intronic
947971453 2:234328691-234328713 GGCTCCCCGGCCTTCCCTGAGGG - Intergenic
948565134 2:238880001-238880023 GGCAGCCCAGAGCCCCGTGAAGG - Intronic
948894076 2:240920172-240920194 GGCAGCCTGGCCCTTCGTGAGGG + Intronic
1170202624 20:13760788-13760810 GGCACCCCTCACCTCCCAGACGG - Intronic
1170811443 20:19678293-19678315 GGCACCCCTCACCTCCCAGACGG + Intronic
1171951948 20:31427829-31427851 GGCGCCCCTCACCTCCGGGACGG - Intergenic
1172059357 20:32176851-32176873 GGCACCCCTCACCTCCCAGACGG - Intergenic
1172209072 20:33185098-33185120 GGCACCCCTCACCTCCCAGACGG + Intergenic
1172337980 20:34132775-34132797 GGCACCCCTCACCTCCCGGATGG - Intergenic
1172349542 20:34229923-34229945 GGCACCCCTCACCTCCCGGAAGG + Intronic
1172349865 20:34230677-34230699 GGCACCCCTCACCTCCCGGAAGG + Intronic
1172722868 20:37012820-37012842 GGCGCCCCTCACCTCCCTGACGG - Intronic
1172768672 20:37364379-37364401 GCCACCCAGGAGCACCGTGATGG + Intronic
1172819292 20:37718193-37718215 GGCGCCCCTCACCTCCGGGACGG + Intronic
1172819373 20:37718369-37718391 GGCACCCCTCACCTCCGGGACGG + Intronic
1175731444 20:61357050-61357072 GGCACCCCGCATCTCAGTGAGGG - Intronic
1175940410 20:62535176-62535198 GACACCCTGGACCCCCTTGAGGG + Intergenic
1176348286 21:5770665-5770687 GGCACCCCTCACCTCCCGGACGG + Intergenic
1176355100 21:5891249-5891271 GGCACCCCTCACCTCCCGGACGG + Intergenic
1176496541 21:7553790-7553812 GGCACCCCTCACCTCCCGGACGG - Intergenic
1176542607 21:8168735-8168757 GGCACCCCTCACCTCCCGGACGG + Intergenic
1176561558 21:8351780-8351802 GGCACCCCTCACCTCCCGGACGG + Intergenic
1177178453 21:17720495-17720517 GGCACCCCTCACCTCCCGGATGG + Intergenic
1185315144 22:50175745-50175767 GGCAGCCGGGAGCTCCGTGTGGG + Intronic
1185333463 22:50261668-50261690 GGCACCTGGGACATCCCTGAGGG - Exonic
952308958 3:32170007-32170029 GGCACCCCTCACCTCCCGGACGG - Intergenic
953084904 3:39656015-39656037 GGCACCCCCCACCTCCCAGACGG - Intergenic
954399322 3:50311528-50311550 GGCGCCCCTCACCTCCGGGATGG + Intronic
955434779 3:58890265-58890287 GGCACCCCTCACCTCCCGGACGG + Intronic
958407112 3:93764279-93764301 GGCACCCCTCACCTCCCAGACGG + Intergenic
958407190 3:93764539-93764561 GGCACTCCTGACCTCCCAGACGG + Intergenic
958957438 3:100478041-100478063 GGCACCCCTCACCTCCCAGACGG + Intergenic
959415629 3:106074706-106074728 GGCACCCCTCACCTCCCGGACGG + Intergenic
960029955 3:113046403-113046425 GGCACCCCTCACCTCCCGGATGG + Intergenic
960770715 3:121190639-121190661 GGCACCCCCCACCTCCCAGATGG + Intronic
961784211 3:129339319-129339341 GGCACCCCTCACCTCCCGGACGG + Intergenic
962112963 3:132471200-132471222 GGCACCCCTCACCTCCCGGACGG + Intronic
962688870 3:137872936-137872958 GGCACCCCCCACCTCCCGGACGG - Intergenic
965136969 3:164784668-164784690 GGCACCCCCCACCTCCCAGATGG - Intergenic
965692284 3:171370655-171370677 GGCAACCCGAGCCTCCTTGAGGG + Intronic
967524332 3:190473608-190473630 GGCACCCCTCACCTCCCGGATGG - Intergenic
968307071 3:197657493-197657515 TGAGCCCCGGAGCTCCGTGAAGG + Intergenic
968436372 4:592349-592371 GGCACCCCTCACCTCCCGGACGG - Intergenic
968573186 4:1353200-1353222 GGCACCCCTGACCCCCGGGACGG + Exonic
973109322 4:46378067-46378089 GGCGCCCCTCACCTCCCTGATGG - Intronic
975685758 4:76917257-76917279 GGCACCCCTCACCTCCCGGACGG - Intergenic
975848469 4:78548333-78548355 GGCACCCCTCACCTCCCGGACGG - Intergenic
975848521 4:78548460-78548482 GGCGCCCCTCACCTCCCTGACGG - Intergenic
982723559 4:158882407-158882429 GGCACCCCCCACCTCCCGGACGG - Intronic
982820581 4:159939073-159939095 GGCGCCCCTCACCTCCGGGATGG + Intergenic
983604691 4:169570586-169570608 GGCACCCCTCACCTCCTGGACGG - Intronic
988709103 5:33755723-33755745 GGCACCCCAGACTTGTGTGATGG + Intronic
989061416 5:37415367-37415389 GGCACCCCTCACCTCCCGGACGG + Intronic
991907142 5:71525348-71525370 GGCACCCCTCACCTCCCGGATGG + Intronic
992290138 5:75271565-75271587 GGCGCCCCTCACCTCCGGGACGG - Intergenic
992801919 5:80301743-80301765 GGCGCCCCTCACCTCCCTGACGG - Intergenic
992978161 5:82139971-82139993 GGCGCCCCTCACCTCCCTGACGG - Intronic
993496711 5:88616224-88616246 GGCACCCCTCACCTCCCAGATGG - Intergenic
997565242 5:134881900-134881922 GGCGCCCCTGACCTCCCGGACGG + Intronic
999270390 5:150293513-150293535 GGCACCCCCCACCTTCCTGAGGG + Intergenic
999369879 5:151048221-151048243 TGCACCCTGAACCTCCGCGAGGG + Intronic
1000985507 5:167859638-167859660 GGCACCCCTCACCTCCCAGACGG - Intronic
1002205454 5:177560052-177560074 GGCACCCCTCACCTCCCGGATGG + Intergenic
1002776248 6:330070-330092 GGCACCCGGCACCTCCCTCATGG + Intronic
1004428539 6:15523093-15523115 GCCACCCGGGACATCAGTGAGGG - Exonic
1004874414 6:19939647-19939669 GGCACCCCTCACCTCCCGGACGG - Intergenic
1005063439 6:21797198-21797220 GGCACCCCTCACCTCCTGGACGG + Intergenic
1005859201 6:29888269-29888291 GGCGACCCGGCCCTCCGTGGGGG - Intergenic
1005864356 6:29926974-29926996 GGGACCCGGGACGTCCGTGGGGG - Intergenic
1006128399 6:31854273-31854295 GGCACCCCTCACCTCCCGGACGG + Intergenic
1006231997 6:32595126-32595148 GGCACCCCTCACCTCCCGGACGG + Intergenic
1006232127 6:32595405-32595427 GGCACCCCTCACCTCCCGGACGG + Intergenic
1006232333 6:32595858-32595880 GGCACCCCTCACCTCCCGGACGG + Intergenic
1006546722 6:34786771-34786793 GGCACCCCTCACCTCCCGGACGG - Intergenic
1007072620 6:39048484-39048506 GGCACCCCGGACCTCCTCCCGGG - Intergenic
1007295193 6:40815933-40815955 GGCACCCCCCACCTCCCAGACGG - Intergenic
1007302288 6:40876403-40876425 GGCAGCCCCCACCTCAGTGAAGG + Intergenic
1007303989 6:40890419-40890441 TCCACCCCAGACCTCTGTGAAGG + Intergenic
1007523117 6:42466819-42466841 GGCACCCCTCACCTCCCGGACGG - Intergenic
1007631635 6:43276099-43276121 GGGACTCAGGACCTCCGCGAGGG - Intronic
1008919286 6:56824907-56824929 GGCACCCCTCACCTCCCGGACGG - Intronic
1010030425 6:71266474-71266496 GGCACCCCTCACCTCCCGGACGG + Intergenic
1010513252 6:76744693-76744715 GGCACCCCTCACCTCCCGGACGG - Intergenic
1011148620 6:84244793-84244815 GGCGCCCCTCACCTCCCTGACGG + Intergenic
1011426687 6:87239265-87239287 GGCACCCCTCACCTCCCGGACGG + Intronic
1014557035 6:122849262-122849284 GGCACCCCTCACCTCCCGGACGG + Intergenic
1016123585 6:140373806-140373828 GGCACCCCCCACCTCCCGGATGG + Intergenic
1017493703 6:154966185-154966207 GGCACCCCTCACCTCCCAGACGG + Intronic
1018915422 6:168129750-168129772 GCCACCCCTGACCCCCGTGGTGG - Intergenic
1019393346 7:802322-802344 GGCACCCCGGAGCTGAGTGGAGG - Intergenic
1019428093 7:986805-986827 GGGACCCAAGACCTCCTTGAAGG + Intronic
1019439223 7:1038336-1038358 GGCACCCCTCACCTCCCGGACGG - Intronic
1021672179 7:23045880-23045902 GGCACCCCTCACCTCCCGGACGG + Intergenic
1022083523 7:27045430-27045452 GGCACCCCTCACCTCCCGGACGG - Intergenic
1025103045 7:56150959-56150981 GGCACCCCTCACCTCCCGGACGG - Intergenic
1025800925 7:64785113-64785135 GGCACCCCTCACCTCCCAGACGG - Intergenic
1028227407 7:88266516-88266538 GGCACCCCTCACCTCCCGGAGGG + Intergenic
1028595626 7:92544956-92544978 GGCGCCCCCGACCTCCCGGACGG + Intergenic
1028685463 7:93585918-93585940 GGCACCCCTCACCTCCCGGATGG + Intergenic
1028685514 7:93586045-93586067 GGCACCCCTCACCTCCCGGATGG + Intergenic
1030036289 7:105410895-105410917 GGCACCCCTCACCTCCCGGACGG + Intergenic
1032291298 7:130591506-130591528 GGCACCCCTCACCTCCCGGATGG - Intronic
1032557147 7:132848214-132848236 GGCACCCTGGACCTCTTTGTTGG - Intronic
1033323969 7:140362807-140362829 GGCGCCCCTCACCTCCGGGACGG - Intronic
1034450040 7:151132392-151132414 GCCACCCCAGTCCTCTGTGAGGG - Intronic
1035412645 7:158657561-158657583 GGCACCCCTCACCTCCCGGACGG - Intronic
1035563674 8:627629-627651 GGCACCCCGGACCTCCGTGAAGG - Intronic
1036632662 8:10526141-10526163 GGCCCCCCAGAGCTCCCTGATGG + Intronic
1039072127 8:33658121-33658143 GGCACCCCTCACCTCCCGGACGG + Intergenic
1039153300 8:34529171-34529193 GGCACCCCTCACCTCCCGGACGG + Intergenic
1040121164 8:43687459-43687481 GGCACCCCTCACCTCCCAGATGG + Intergenic
1040785559 8:51159368-51159390 GGCACCCCTCACCTCCCGGATGG - Intergenic
1041270378 8:56104503-56104525 GGCGCCCCTCACCTCCCTGACGG + Intergenic
1041358159 8:57022282-57022304 GGCACCCCTCACCTCCCGGACGG - Intergenic
1041796554 8:61753036-61753058 GGCACCCCTCACCTCCCGGACGG + Intergenic
1041920751 8:63179930-63179952 GGCACCCCTCACCTCCCGGACGG + Intronic
1042307917 8:67350860-67350882 GGCACCCCTCACCTCCCGGACGG - Intergenic
1044223773 8:89699108-89699130 GGCACCCCTCACCTCCCGGACGG - Intergenic
1044582158 8:93834265-93834287 GGCACCCCTCACCTCCCAGACGG + Intergenic
1047781907 8:128118401-128118423 GGCACCCCTCACCTCCCGGAGGG + Intergenic
1050090977 9:2016366-2016388 GGCACCTCCGACCTCCTTGGGGG - Intronic
1050610258 9:7344802-7344824 TGCACCCCTGCCCTCCCTGAGGG - Intergenic
1051661780 9:19433740-19433762 GGCACCCCTCACCTCCCGGATGG + Intronic
1054801651 9:69355738-69355760 ACTGCCCCGGACCTCCGTGATGG + Intronic
1055137043 9:72840434-72840456 GGCACCCCTCACCTCCCGGATGG + Intergenic
1055137471 9:72841416-72841438 GGCACCCCTCACCTCCCGGACGG + Intergenic
1056564055 9:87758268-87758290 GGCACCCCTCACCTCCCGGACGG + Intergenic
1056564108 9:87758395-87758417 GGCACCCCTCACCTCCCGGACGG + Intergenic
1056564157 9:87758522-87758544 GGCACCCCTCACCTCCCAGACGG + Intergenic
1056564209 9:87758649-87758671 GGCACCCCTCACCTCCCGGACGG + Intergenic
1056564323 9:87758941-87758963 GGCACCCCTCACCTCCCAGACGG + Intergenic
1058244127 9:102603301-102603323 GGCACCCCCCACCTCCCAGACGG + Intergenic
1058661681 9:107272497-107272519 GGCACCCCTCACCTCCCGGATGG - Intergenic
1059121088 9:111641434-111641456 GGCACCCCTCACCTCCCAGACGG - Intronic
1059352769 9:113677252-113677274 GGCACCCGGGCCCTCCAGGAGGG - Intergenic
1060073926 9:120574942-120574964 GCCACCCCCAACCTCCGGGAAGG - Intronic
1061761452 9:132854723-132854745 GGCAAACGGGAACTCCGTGAAGG - Intronic
1061982922 9:134116122-134116144 GGCACCCCTCACCTCCCGGAAGG + Intergenic
1061983246 9:134116876-134116898 GGCACCCCTCACCTCCCGGAAGG + Intergenic
1061983547 9:134117581-134117603 GGCACCCCTCACCTCCCGGAAGG + Intergenic
1061983871 9:134118335-134118357 GGCACCCCTCACCTCCCGGAAGG + Intergenic
1186786982 X:12963604-12963626 GGCACCCCTCACCTCCCGGACGG - Intergenic
1186854473 X:13612631-13612653 GGCACCCCCCACCTCCCAGACGG + Intronic
1187844520 X:23522942-23522964 GGCACCCCTCACCTCCCAGACGG - Intergenic
1187844533 X:23522979-23523001 GGCACCCCTCACCTCCGAGACGG - Intergenic
1189210381 X:39278069-39278091 GGCACCCCTCACCTCCCGGACGG - Intergenic
1189457956 X:41211567-41211589 GGCACCCCTCACCTCCCGGACGG - Intronic
1189458027 X:41211743-41211765 GGCACCCCTCACCTCCCGGATGG - Intronic
1189458080 X:41211870-41211892 GGCACCCCTCACCTCCCGGATGG - Intronic
1189569941 X:42285619-42285641 GGCACCCCTCACCTCCCGGACGG + Intergenic
1189837901 X:45041080-45041102 GGCACCCCTCACCTCCCGGACGG + Intronic
1189956034 X:46276051-46276073 GGCGCCCCTCACCTCCGGGACGG - Intergenic
1189968478 X:46395919-46395941 GGCACCCCTCACCTCCCAGACGG + Intergenic
1191009950 X:55748816-55748838 GGCACCCCTCACCTCCCGGACGG - Intronic
1192476919 X:71452062-71452084 GGCACCCCTCACCTCCCGGACGG + Intronic
1192663975 X:73069221-73069243 GGCACCCCTCACCTCCCAGACGG - Intergenic
1193068174 X:77279711-77279733 GGCACCCCTCACCTCCCAGACGG - Intergenic
1193132243 X:77931726-77931748 GGCACCCCTCACCTCCCGGACGG + Intronic
1197455801 X:126674295-126674317 GGCACCCCCCACCTCCTGGATGG - Intergenic
1198246908 X:134839593-134839615 GGCACCCCTCACCTCCCGGATGG - Intronic
1199452630 X:147992421-147992443 GGCACCCCTCACCTCCCAGACGG + Intronic
1200047100 X:153408977-153408999 GTCACCCTGGACCTCCCTGCTGG + Intergenic
1201282296 Y:12352332-12352354 GGCACCCCCCACCTCCCGGATGG - Intergenic