ID: 1035564972

View in Genome Browser
Species Human (GRCh38)
Location 8:635368-635390
Sequence CTTTGGAGGGAAGCTCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 569
Summary {0: 1, 1: 0, 2: 2, 3: 69, 4: 497}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035564972_1035564983 20 Left 1035564972 8:635368-635390 CCAGCCTGAGCTTCCCTCCAAAG 0: 1
1: 0
2: 2
3: 69
4: 497
Right 1035564983 8:635411-635433 ACTAACAATAGTGACAGCTAAGG No data
1035564972_1035564984 24 Left 1035564972 8:635368-635390 CCAGCCTGAGCTTCCCTCCAAAG 0: 1
1: 0
2: 2
3: 69
4: 497
Right 1035564984 8:635415-635437 ACAATAGTGACAGCTAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035564972 Original CRISPR CTTTGGAGGGAAGCTCAGGC TGG (reversed) Intronic
900227462 1:1539964-1539986 CTGGGGAGGGGAGCGCAGGCCGG + Intronic
900681120 1:3916989-3917011 TTTGGGAGGGAAGCCGAGGCAGG + Intergenic
900797108 1:4714803-4714825 CTTGGCTGGGAAGCTCAGGATGG - Intronic
901449604 1:9327947-9327969 CTTTGGTGAGAAACTGAGGCTGG - Intronic
901689587 1:10964064-10964086 CTTTAGAGAGAAGCCCAGCCTGG + Intronic
901936557 1:12630807-12630829 CTTAGGAGGGAAGCCAAGGGGGG + Intergenic
902094518 1:13931947-13931969 CTTGGGAGGGAGGTTGAGGCAGG - Intergenic
902564452 1:17301732-17301754 GTTGGGAGAGAAGCTGAGGCAGG + Intergenic
902585419 1:17436255-17436277 CTTTGGAAGGAGGCTGAGGCAGG + Intronic
903291052 1:22314551-22314573 TTTGGAAGGGAAGCTCAGGAAGG + Intergenic
903601926 1:24548552-24548574 CTTTGGGAGGAGGCTGAGGCAGG + Intergenic
903608122 1:24589932-24589954 CTCTTGAGGGAGGCTGAGGCAGG - Intronic
904253442 1:29240024-29240046 CTTTGGTAAGAAGGTCAGGCTGG - Intronic
904409240 1:30314970-30314992 GATTGGAGGGAACCTGAGGCAGG + Intergenic
904811320 1:33165181-33165203 CTTTGGGTGGAAGTTGAGGCGGG - Intronic
905529115 1:38662375-38662397 GCTTGGAGGCAAGCTCAGGAAGG + Intergenic
905559687 1:38916599-38916621 CTTTGGCGGGAGGCTGAGGCAGG + Intronic
905787211 1:40767731-40767753 TTTGGGAGGGAGGCTGAGGCAGG + Intronic
906308113 1:44734153-44734175 CTCAGGAGGGAGGCTGAGGCAGG - Intergenic
907284304 1:53370357-53370379 CTTCTGAGGAAAGCTCAGGAGGG + Intergenic
907291763 1:53418475-53418497 CTGTGGTGGGAGGCTGAGGCAGG + Intergenic
907455355 1:54572030-54572052 CAGGGGAGGGCAGCTCAGGCAGG + Intronic
908084616 1:60617496-60617518 CTGTGGAGGGTATCTAAGGCAGG + Intergenic
908240318 1:62183750-62183772 GTTGGGAGAGAAGCTGAGGCAGG - Intergenic
908249086 1:62251101-62251123 CTTTGGAGAAAAGGGCAGGCAGG + Intronic
908831217 1:68180429-68180451 GTTGGGAGGGAAACTGAGGCAGG + Intronic
908983485 1:69987131-69987153 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
909411231 1:75354364-75354386 GTTGGGAGAGAAGCTGAGGCAGG + Intronic
910122316 1:83803979-83804001 CTTTGGTGGGAGGCCAAGGCAGG + Intergenic
911213535 1:95167454-95167476 GTTGGGAGAGAAGCTGAGGCAGG + Intronic
911419366 1:97620324-97620346 CTTAGGAGGGAGGCTGAGGCTGG - Intronic
911960163 1:104291796-104291818 CTCAGGAGGGAGGCTGAGGCAGG - Intergenic
912403201 1:109413682-109413704 CTTGGGAGAGAAACTTAGGCTGG - Intronic
912550001 1:110479384-110479406 CTCAGGAGGGAACCTCAGGAGGG - Intergenic
912752601 1:112298148-112298170 CATTGGAGGGAAGCTGAGCAAGG + Intergenic
913459613 1:119070371-119070393 CTTGGGAGGGAGGCTGAGGCAGG - Intronic
914994598 1:152531691-152531713 GTTGGGAGAGAAGCTGAGGCAGG - Intronic
915337406 1:155153288-155153310 CTTTGGAAGGAATCCCAGCCTGG - Intergenic
915388321 1:155517519-155517541 CTTGGGAGGGAGGCTGAGGCAGG + Intronic
916885163 1:169060279-169060301 CTCTGGAGGGAAACACAGTCAGG - Intergenic
918275572 1:182950856-182950878 CTTTTTAGGGAGGCTGAGGCAGG - Intronic
918415935 1:184308967-184308989 CTCAGGAGGGAGGCTAAGGCAGG - Intergenic
919098685 1:193067295-193067317 CTCAGGAGGGAGGCTGAGGCAGG - Intronic
919629996 1:199951171-199951193 GGTTGGAGGGCAGCCCAGGCTGG - Intergenic
920101893 1:203522017-203522039 CCGTGGAGGGAAGCCCAGGGTGG + Intergenic
920241034 1:204550659-204550681 CCTGTGAGGGAAGCTGAGGCTGG - Exonic
921031786 1:211340587-211340609 GTTGGGAGGGAAACTGAGGCAGG + Intronic
921339314 1:214118559-214118581 CTTTGGAGTGGAGGTCAGGGAGG + Intergenic
921754354 1:218836794-218836816 CTCGGGAGGGAGGCTGAGGCAGG - Intergenic
922484749 1:225964925-225964947 CTTTGGGAGGAGGCTGAGGCTGG + Intergenic
923222960 1:231913156-231913178 CTTTTTTGGGAAGCTGAGGCTGG - Intronic
924275760 1:242385277-242385299 GTTGGGAGGGAAACTGAGGCAGG + Intronic
924298640 1:242614289-242614311 CTCTGGAGGGAGACTGAGGCTGG - Intergenic
924529574 1:244881894-244881916 CTGGGGAGGAAAGCTCAGTCTGG - Intergenic
1062987548 10:1783264-1783286 CTTTGAAGGGAATCTAAGGTTGG + Intergenic
1063192996 10:3715711-3715733 CTCAGGAGGGAGGCTGAGGCAGG - Intergenic
1063319011 10:5035147-5035169 GTTGGGAGAGAAGCTGAGGCAGG + Intronic
1064435191 10:15304978-15305000 CTTTGGAAGGAGGCTGAGGCAGG - Intronic
1064673051 10:17735192-17735214 CTTTAGAGCAAAGCGCAGGCAGG + Intergenic
1064830582 10:19461601-19461623 CTGTGGGGGGAGGCTGAGGCAGG + Intronic
1065564784 10:26997624-26997646 GTTGGGAGAGAAGCTGAGGCAGG + Intronic
1065976017 10:30842916-30842938 TTTTGGAGTGCTGCTCAGGCTGG - Intronic
1066792698 10:39083381-39083403 GTTGGGAGAGAAGCTGAGGCAGG - Intergenic
1066986400 10:42471855-42471877 GTTGGGAGAGAAGCTGAGGCAGG + Intergenic
1067163915 10:43849725-43849747 CTTCTGACGAAAGCTCAGGCCGG - Intergenic
1067434833 10:46269547-46269569 GTTGGGAGAGAAGCTGAGGCAGG + Intergenic
1068023730 10:51617038-51617060 CTCCAGAGGGAAGCTCATGCTGG - Intronic
1068605983 10:59005517-59005539 CTTTGGAAGGAGACTGAGGCTGG - Intergenic
1069726386 10:70582988-70583010 CTTGGGAGGGAAGCCCTGGGTGG + Intergenic
1070132014 10:73662718-73662740 GTTGGGAGAGAAGCTGAGGCAGG - Intronic
1070909862 10:80108693-80108715 GTTGGGAGAGAAGCTGAGGCAGG + Intergenic
1071533224 10:86404976-86404998 CTTGGGAGGGAGGCTGAGGCAGG + Intergenic
1071609672 10:87021358-87021380 GTTGGGAGAGAAGCTGAGGCAGG + Intronic
1072586454 10:96787081-96787103 GTTGGGAGAGAAGCTGAGGCAGG + Intergenic
1073123089 10:101133752-101133774 CTGTGGATGGAGGCTCAGGTCGG + Intronic
1073241722 10:102063546-102063568 CTAGGGAGGGAGGCTTAGGCAGG + Intergenic
1073961446 10:108934698-108934720 CTTGGGAGGTAAGCTGGGGCAGG + Intergenic
1074122462 10:110503038-110503060 TCTTGGATGGAAGCTCAAGCTGG - Intronic
1074203403 10:111259510-111259532 CTTGGGAGGGAGGCTGAGGCAGG + Intergenic
1074300279 10:112227026-112227048 GTTGGGAGAGAAGCTGAGGCAGG - Intergenic
1075442609 10:122492000-122492022 ATTTCGGGGGAAGCTCTGGCTGG + Intronic
1075462293 10:122624928-122624950 TCTTGAAGAGAAGCTCAGGCTGG - Intronic
1076152654 10:128175231-128175253 GTTGGGAGAGAAGCTGAGGCAGG - Intergenic
1076204722 10:128587900-128587922 CCATAGTGGGAAGCTCAGGCTGG + Intergenic
1076320728 10:129579519-129579541 CTTTGGAAGGACGTTAAGGCAGG + Intronic
1076434502 10:130430824-130430846 CTGTGGAGGGCGCCTCAGGCAGG - Intergenic
1077908304 11:6551994-6552016 CTAGGGAGGGAGGCTTAGGCAGG + Intronic
1077912681 11:6586951-6586973 CATAGGAGGGAAGCTGAGGGAGG + Intronic
1078363091 11:10685198-10685220 CTTTGAAAGGAGGCTGAGGCAGG + Intronic
1078569959 11:12449263-12449285 CCGTGGAGGGAGGCTGAGGCGGG - Intronic
1078592434 11:12655372-12655394 CTTGGGAGGGAGGCTGAGGCAGG + Intergenic
1080414920 11:32060537-32060559 CTTAGGAGGGAGGCTGAGGCAGG + Intronic
1081315877 11:41629102-41629124 CTCAGGAGGGAGGCTGAGGCAGG + Intergenic
1081516986 11:43842382-43842404 CCTTGGATGAAAGCTCAGGTCGG - Intronic
1082181185 11:49121676-49121698 CTCGGGAGGCAAGCTGAGGCAGG - Intergenic
1082693004 11:56328145-56328167 ATTGGGAGAGAAGCTGAGGCAGG - Intergenic
1082904913 11:58297176-58297198 CTTTAGAGGGATACTGAGGCAGG - Intergenic
1083267426 11:61553264-61553286 CTTTGGCAGGACCCTCAGGCAGG + Intronic
1083491465 11:63017462-63017484 GGTAGGAGGGAAGCTCAGTCTGG - Intergenic
1083675945 11:64324684-64324706 CTGGGGAGGGAGGCTGAGGCAGG + Intergenic
1083784945 11:64939207-64939229 CTTGGGAGGGAGGCTGAGGCAGG - Intronic
1084169559 11:67394193-67394215 CTCTGGAAGGATGCCCAGGCCGG - Intronic
1084593651 11:70104776-70104798 CTTTGGATGGAAGCTCTGGCGGG + Intronic
1084703212 11:70801134-70801156 GTTTGGAAGGAAAGTCAGGCAGG - Intronic
1084771703 11:71347118-71347140 CCATGGTGGGAAGCACAGGCAGG + Intergenic
1086539066 11:87885964-87885986 GTTGGGAGAGAAGCTGAGGCAGG + Intergenic
1086955462 11:92930517-92930539 CTTGGGAGGGGAGCACATGCAGG + Intergenic
1087193433 11:95280657-95280679 CTTTGGAGGGGAATTCTGGCAGG + Intergenic
1087483590 11:98733305-98733327 GTTGGGAGAGAAGCTGAGGCAGG + Intergenic
1088366668 11:109047135-109047157 CTTTGCAGGGAGGGTCAGGGAGG + Intergenic
1088931643 11:114357378-114357400 GTTGGGAGGGAAACTGAGGCAGG + Intergenic
1089798637 11:121004942-121004964 CCTGGGAGGGAAGCTGAGGTGGG - Intergenic
1089835348 11:121365576-121365598 CTTTGGAGAAAAGCTCTGGCTGG - Intergenic
1090226245 11:125073837-125073859 TTTTGGTGGGAAGCGCAGACAGG - Intronic
1091125573 11:133092478-133092500 TTTGGGAGGGAAGCTGAGGCGGG + Intronic
1091288969 11:134426397-134426419 CTTTGCAGGGAGGACCAGGCAGG + Intergenic
1091576719 12:1743561-1743583 CTCTGGATGGAGGCTGAGGCGGG + Intronic
1092243437 12:6849667-6849689 GTTTGGAGGGGAACTCAGTCTGG + Exonic
1092776459 12:11948632-11948654 TTCTGGGGGGAGGCTCAGGCTGG - Intergenic
1093302318 12:17472230-17472252 GTTGGGAGGGAAACTGAGGCAGG + Intergenic
1094401368 12:30063939-30063961 GTTGGGAGGGAAACTGAGGCAGG + Intergenic
1095699443 12:45175857-45175879 GTTGGGAGAGAAGCTGAGGCAGG + Intergenic
1096058663 12:48677671-48677693 CTTGGGAGGGAGGCTGAGGCAGG + Intronic
1096470119 12:51870291-51870313 CTTTGCAGGGAAGCTGTGGGTGG - Intergenic
1096531103 12:52243351-52243373 CTGTGGAGGGAGACTCAGGCTGG + Intronic
1097003888 12:55901204-55901226 CTCGGGAGGGAGGCTGAGGCAGG + Intergenic
1097475018 12:60042759-60042781 CATTGCAAGGAAGCTCATGCTGG + Intergenic
1097668270 12:62506486-62506508 CTTTGGGAGGAGGCTGAGGCAGG + Intronic
1098818507 12:75199897-75199919 CTTGGGAGGTAAGCTCCTGCAGG + Intronic
1098964544 12:76772966-76772988 CTCGGGAGGGAGGCTGAGGCAGG - Intronic
1099463718 12:82956559-82956581 CTTGGGAGGGAGGCTGAGGCAGG - Intronic
1100884467 12:99054788-99054810 CTTTGGGAGGAAGCCAAGGCAGG - Intronic
1100941790 12:99731046-99731068 TTTGGGAGGGAGGCTGAGGCAGG - Intronic
1101428093 12:104604242-104604264 CTTGGGAGGGAAACTAGGGCTGG + Intronic
1102828545 12:115972613-115972635 CTCTGGAGGAAAGCACTGGCAGG + Intronic
1103898215 12:124288405-124288427 CTCTGGAGAAAAGTTCAGGCAGG - Intronic
1104003072 12:124872838-124872860 CTCGGGAGGGAGGCTGAGGCAGG - Intronic
1104891433 12:132142063-132142085 CTCAGCAGGGAAGCTGAGGCGGG + Intronic
1105296562 13:19091605-19091627 CTTTGGGAGGAGGCCCAGGCAGG + Intergenic
1105600720 13:21884677-21884699 CTTGGAAAGTAAGCTCAGGCAGG + Intergenic
1105665522 13:22551923-22551945 GTTGGGAGAGAAGCTGAGGCAGG - Intergenic
1105862960 13:24433067-24433089 GTTGGGAGGGAAACTGAGGCAGG + Intronic
1106265458 13:28105579-28105601 CTTGGGAGGGAGGCTGAGGCAGG + Intergenic
1107312479 13:39093929-39093951 GTTGGGAGGGAAACTGAGGCAGG + Intergenic
1108022048 13:46137426-46137448 ATTTGGTGGGAGGCTGAGGCAGG + Intronic
1108199865 13:48032400-48032422 GTTGGGAGAGAAGCTGAGGCAGG - Intergenic
1108329685 13:49372780-49372802 CTCTGGAGGGAGGCTGAGGCAGG - Intronic
1108536247 13:51382967-51382989 CTTGGGAGGGAGGCTGAGGCAGG + Intronic
1108868596 13:54952963-54952985 CTTGGGAGGGAGGCTGAGGTGGG + Intergenic
1109606485 13:64704693-64704715 GTTGGGAGGGAAACTGAGGCAGG - Intergenic
1110342892 13:74413708-74413730 CATGGGAGGGAGGCTGAGGCAGG + Intergenic
1110776399 13:79412931-79412953 CTTGGAAGGGAGGCTGAGGCAGG + Intergenic
1110878012 13:80534794-80534816 CTTTGGAAAGATGCTCAGCCTGG + Intergenic
1111805790 13:93039410-93039432 GTTGGGAAGAAAGCTCAGGCAGG + Intergenic
1113335936 13:109375951-109375973 CTCAGGAGGGAAGCTAAGGCAGG - Intergenic
1113832211 13:113304899-113304921 CTTTGGTGGGAAGCTGAGGCAGG - Intronic
1114082840 14:19216425-19216447 CTTGGGAGGGAGGCTGAGGTGGG + Intergenic
1115345756 14:32341772-32341794 CATTTTAGGGAAGCTCAGGAGGG + Intronic
1115648967 14:35389694-35389716 CTCAGGAGGGAGGCTGAGGCAGG - Intergenic
1116523791 14:45880387-45880409 CTTTGGAGGAGAGTTCAGCCAGG + Intergenic
1118735306 14:68696806-68696828 CTGGGGAAGGAAGCCCAGGCAGG + Intronic
1119477291 14:74938368-74938390 TGTTGGAAGGAAGCTCAAGCTGG - Intergenic
1119494983 14:75070402-75070424 TTTTGAAGGGAAGCTTTGGCAGG + Intronic
1119835076 14:77742141-77742163 CTTGGGAGGGAGGCTGAGGCAGG - Intronic
1120039517 14:79736809-79736831 GTTGGGAGAGAAGCTGAGGCAGG - Intronic
1120990494 14:90372669-90372691 TTTGGGAGGGAGGCTGAGGCGGG - Intergenic
1121409721 14:93741360-93741382 CATGGGAGGGAAGTTCAGGCAGG - Intronic
1121549628 14:94789051-94789073 CTTGGGAGGGAGGCTGAGGCAGG - Intergenic
1121905235 14:97735219-97735241 CTAGGGAGGGAGGCTGAGGCAGG - Intergenic
1122579417 14:102762273-102762295 CTTTGGGGGGAGGCTGAGGATGG + Intergenic
1122930217 14:104929695-104929717 CTGTGGGTGGAGGCTCAGGCTGG + Intronic
1123027350 14:105432953-105432975 CTTTCGACTGAAGCTCAGGCGGG - Intronic
1123755201 15:23392447-23392469 TTCTGGAGGGAGGCTGAGGCGGG - Intergenic
1124375027 15:29124308-29124330 GTGTGGCGTGAAGCTCAGGCTGG - Intronic
1124402021 15:29356931-29356953 CTTTGGAGGGAAGAGAAAGCTGG + Intronic
1124869586 15:33527470-33527492 CTCAGGAGGGAGGCTGAGGCAGG + Intronic
1125553237 15:40563738-40563760 CTTTGGAGAAAAGTGCAGGCTGG - Intronic
1126078601 15:44937235-44937257 CTTGGGAGGGGAGCTGGGGCTGG - Intergenic
1126079247 15:44943090-44943112 CTTGGGAGGGGAGCTGGGGCTGG + Intergenic
1126780131 15:52132717-52132739 CTCTGTTGGGAAGCTGAGGCGGG - Intronic
1127258496 15:57310631-57310653 CTTTGGTGGGAAGGTGAGACTGG - Intergenic
1127330342 15:57932743-57932765 TTTTGGGGGGAAGCTCAAGGAGG + Intergenic
1127768628 15:62212085-62212107 GTTGGGAGAGAAGCTGAGGCAGG - Intergenic
1127769205 15:62217085-62217107 GTTTGGAGAGAAGCTGAGGCGGG - Intergenic
1127776773 15:62270171-62270193 GTTGGGAGAGAAGCTGAGGCAGG - Intergenic
1128057687 15:64712854-64712876 CTTGGGAGGGAGGCTGAGGCAGG - Intergenic
1128435484 15:67643690-67643712 CTTTGGGAGGAGGCTGAGGCGGG - Intronic
1129152273 15:73696602-73696624 CTCTGGAGGGAAGCGCAGCTCGG + Intronic
1129286975 15:74533417-74533439 CTCTGATGGGAAGCTGAGGCAGG - Intergenic
1129618344 15:77119234-77119256 CTTTGGAGAATAGCTCAAGCGGG - Intronic
1129782397 15:78281423-78281445 CTTTGGAAGGGAGCTCAATCTGG - Exonic
1130111850 15:80971836-80971858 CTTGGGAGGGAGGCTGAGGTGGG + Intronic
1131261612 15:90890775-90890797 CTGGGAAGGGAAGCCCAGGCAGG - Intronic
1131828245 15:96336842-96336864 CTTTGGGGGGAATCTGAGGCTGG + Intronic
1132488769 16:213008-213030 CTTTGGTGGGAGGCAGAGGCCGG - Intronic
1132534188 16:469181-469203 CTTGGGAGGGAGGCTGAGGCAGG - Intronic
1132828051 16:1914654-1914676 CTTTGGAGAGAAGGCCTGGCAGG - Intronic
1133542757 16:6772378-6772400 CTTTGGAGGTGGGCACAGGCTGG + Intronic
1134615422 16:15647782-15647804 TTTGGGAGGGAGGCTGAGGCAGG + Intronic
1134623267 16:15705871-15705893 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
1134741880 16:16555052-16555074 CTTGGGAGGGAGGTTGAGGCAGG - Intergenic
1134925678 16:18157404-18157426 CTTGGGAGGGAGGTTGAGGCAGG + Intergenic
1136581470 16:31153833-31153855 GTAAGGAGGGAAGCTCAAGCAGG + Intergenic
1138175835 16:54897493-54897515 CTTGGGAGGGAGGCTGAGGCAGG + Intergenic
1140218420 16:73026259-73026281 CTTGGGAGGGAGGCTGAGGCAGG + Intronic
1140459905 16:75131222-75131244 ATGAGGAGGGAAGCTCAGGGAGG + Intergenic
1140865665 16:79059600-79059622 CTTGGGAGGCAGGCTGAGGCAGG - Intronic
1141006952 16:80361430-80361452 CTTTTAAAGGAATCTCAGGCCGG + Intergenic
1141644314 16:85359123-85359145 CTCTGGGTGGCAGCTCAGGCTGG + Intronic
1141951143 16:87340173-87340195 CTTGGGAGTGAGGCTGAGGCAGG + Intronic
1142358009 16:89613124-89613146 GTTGGGAGGGAAACTGAGGCAGG - Intergenic
1143232939 17:5372865-5372887 CTAGGGAGGGAGGCTGAGGCCGG - Intronic
1143666022 17:8361225-8361247 CCCTGGCAGGAAGCTCAGGCTGG + Intergenic
1144526438 17:15994404-15994426 TTTTGGAGTGTAACTCAGGCTGG - Intronic
1144878763 17:18419743-18419765 GTTGGGAGAGAAGCTGAGGCAGG + Intergenic
1144956530 17:19021524-19021546 CTTTTGAGGGAGGGGCAGGCAGG + Exonic
1145109306 17:20147928-20147950 CTTGGGAGGGAGGCTGAGGTGGG + Intronic
1145153474 17:20524651-20524673 GTTGGGAGAGAAGCTGAGGCAGG - Intergenic
1145159248 17:20563449-20563471 GTTGGGAGAGAAGCTGAGGCAGG - Intergenic
1145207712 17:20993470-20993492 CTGTGGATGGAAGGTTAGGCTGG + Intergenic
1145910571 17:28539745-28539767 CTCAGGAGGGAGGCTGAGGCAGG + Intronic
1146769809 17:35558502-35558524 TTTGGGAGGGAGGCCCAGGCAGG - Intergenic
1147300828 17:39525936-39525958 CATTTGAGGGATGCTCAGGTCGG - Exonic
1147316620 17:39623953-39623975 CTTTGGAGGGAAAATCTGGGAGG - Intergenic
1147426499 17:40348228-40348250 CTTAGGAGGGACGGTGAGGCAGG + Intronic
1149256896 17:54837016-54837038 CATGGGAGGGAAGCTGAGGTGGG - Intergenic
1150156909 17:62861396-62861418 CTTGGGAGGGAGGCTGAGCCAGG - Intergenic
1150420343 17:65028295-65028317 CTTGGGAGGGAGGTTGAGGCAGG + Intronic
1151187096 17:72372378-72372400 TGGTGGAGGGAAGCTCAGCCTGG - Intergenic
1151237065 17:72728328-72728350 CTTGGGAGGGATGCTGAGGTGGG + Intronic
1151457632 17:74235780-74235802 CTTGGGAGGGAGGCTGAGGCAGG + Intronic
1151482842 17:74380300-74380322 CTTCGGAGGGAGGGGCAGGCAGG + Intergenic
1151498691 17:74474853-74474875 CTTTGGAAGGGGGCTCAGGTAGG + Intronic
1151587973 17:75022593-75022615 GTTGGGAGAGAAGCTGAGGCAGG + Intergenic
1151588890 17:75030194-75030216 GTTGGGAGAGAAGCTCAGGCAGG + Intergenic
1151673466 17:75586021-75586043 GTTGGGAGAGAAGCTCAGGCAGG - Intergenic
1151844910 17:76646004-76646026 CTTTGGAGGGAGGCTGCCGCAGG - Intergenic
1152852880 17:82648131-82648153 CTTCGGAGGGGAGCTCGGGCGGG + Intronic
1152856655 17:82668504-82668526 CATGGGAGGGAAGCTGAGGGAGG - Intronic
1153758030 18:8302850-8302872 CTGTGGAGAGGAGCTCAGGTTGG + Intronic
1155610581 18:27662958-27662980 CGTTGGAGGGAAGATCAGGAAGG - Intergenic
1155812098 18:30249806-30249828 CATGGGAGGGAAGGTCAGGGTGG + Intergenic
1156281675 18:35645339-35645361 CTTGGGAAGGAGGCTGAGGCAGG - Intronic
1157164440 18:45345465-45345487 CTTTGTAGGGAAGCTTTTGCAGG - Intronic
1157236042 18:45966262-45966284 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
1157439485 18:47699430-47699452 ATTTGTTGGGAAGCTGAGGCAGG + Intergenic
1158878313 18:61753124-61753146 CTGAGAAGCGAAGCTCAGGCAGG + Intergenic
1158928999 18:62302630-62302652 CTCGGGAGGGAGGCTAAGGCAGG - Intronic
1159044631 18:63357695-63357717 CTCAGGAGGGAGGCTGAGGCAGG - Intronic
1159594992 18:70374438-70374460 CTTTGGTGGGAGGCTGAGGCAGG + Intergenic
1159889425 18:73940082-73940104 CTCTGTAGGGAGGCCCAGGCAGG - Intergenic
1159890411 18:73948071-73948093 CATTGGAGGAAAGCTCACCCTGG + Intergenic
1160388158 18:78510411-78510433 CTGAGGAGGGAAGCTCAGAAAGG + Intergenic
1160573531 18:79834722-79834744 GTTGGGAGAGAAGCTGAGGCAGG - Intergenic
1160699276 19:498252-498274 AGTTGGAGGGAAGCGAAGGCCGG - Intronic
1160838836 19:1137244-1137266 CAGTGGGGGGAGGCTCAGGCTGG + Intronic
1160839023 19:1137687-1137709 CAGTGGGGGGAGGCTCAGGCTGG + Intronic
1160839077 19:1137812-1137834 CAGTGGGGGGAGGCTCAGGCTGG + Intronic
1160839154 19:1137991-1138013 CAGTGGGGGGAGGCTCAGGCTGG + Intronic
1160839220 19:1138143-1138165 CAGTGGGGGGAGGCTCAGGCTGG + Intronic
1162024124 19:7884214-7884236 CTTGGGAGGGAGGGTGAGGCAGG + Intergenic
1163355174 19:16805978-16806000 CTTGGAAGGGAGGCTGAGGCAGG - Intronic
1163750136 19:19071966-19071988 CTGTGGGGGGATGCTCAGACTGG + Intronic
1163887158 19:19976125-19976147 GTTGGGAGAGAAGCTGAGGCAGG - Intergenic
1163962506 19:20710264-20710286 GTTGGGAGAGAAGCTGAGGCAGG - Intronic
1163962855 19:20713299-20713321 GTTGGGAGAGAAGCTGAGGCAGG - Intronic
1164000632 19:21095178-21095200 GTTGGGAGGGAAACTGAGGCAGG + Intronic
1164123122 19:22286201-22286223 TTTGGGAGGGAAGCCCAAGCGGG - Intergenic
1164187258 19:22881235-22881257 CTTGGGTGGGAGGCTGAGGCAGG - Intergenic
1164407865 19:27970650-27970672 CTTTGCGGGGAGGCTGAGGCGGG + Intergenic
1164939739 19:32243372-32243394 CTTTGGAGGTGAGCAAAGGCTGG - Intergenic
1165006992 19:32815259-32815281 ATTTGGATGGAACCTCAGGTAGG + Intronic
1165289069 19:34868554-34868576 CTCGGGAGGGAGGCTGAGGCAGG - Intergenic
1165660788 19:37578648-37578670 CTGTGCTGGGGAGCTCAGGCGGG - Intronic
1167001932 19:46750635-46750657 CTTAGGAGGGAGGCTGAGGCAGG - Intronic
1167147086 19:47688176-47688198 CTCAGGAGGGAGGCTGAGGCAGG + Intronic
1167963199 19:53123655-53123677 CCTGGGAGGGCAGATCAGGCAGG + Intronic
1167988830 19:53340749-53340771 CCTGGGAGGGCAGATCAGGCAGG - Intronic
1168137281 19:54360129-54360151 CTTTGGATGGGGGCTCAGGGTGG - Intronic
1168160796 19:54508956-54508978 CTTTGGATGGGGGCTCAGGGTGG + Intronic
1168270197 19:55245678-55245700 CCTGGGAGGCAAGCACAGGCGGG + Exonic
1168293961 19:55369902-55369924 CTCCGGAGGGAAACTGAGGCAGG - Intronic
1168374972 19:55869250-55869272 CTCTCGAGGGAAGCTGAGGCTGG + Intronic
926239470 2:11074088-11074110 CTTTGGAGGGGAGTACAGGTGGG - Intergenic
928205733 2:29282021-29282043 CTTTGGAGGGCAGAGCAGGATGG + Intronic
928585897 2:32757803-32757825 CTTGGGTGGGAGGCTGAGGCAGG - Intronic
928813386 2:35256962-35256984 CTTTGTGGGGAGGCCCAGGCAGG + Intergenic
929369854 2:41209986-41210008 GTTGGGAGAGAAGCTGAGGCAGG + Intergenic
929399425 2:41562853-41562875 CTTTGGGTGGAGGCTGAGGCGGG - Intergenic
929784488 2:44979482-44979504 CTCCGGAGGGAGGCTGAGGCAGG - Intergenic
930013756 2:46957021-46957043 CAGTGGAGGGGAGCCCAGGCTGG - Intronic
930660311 2:54046230-54046252 ATTTGGGGGGAGGCTGAGGCGGG + Intronic
931019222 2:58024095-58024117 CTTGGGAGGGAGGCTGAGACAGG - Intronic
931133111 2:59361741-59361763 CTTGCTAGGGAAGCTGAGGCAGG - Intergenic
931346594 2:61452566-61452588 CTTTGGCGGGAGGCTGAGGCGGG - Intronic
932368882 2:71171472-71171494 CTTGGGAGGGGAGCTGGGGCTGG - Intergenic
932721641 2:74142994-74143016 AGGTGGAGGAAAGCTCAGGCAGG - Intronic
932746194 2:74335500-74335522 CTTTCCAGGGTAGCTCAGGTTGG - Intronic
934575762 2:95400325-95400347 CTCAGGAGGGAACCTCAGGAGGG + Intergenic
934746532 2:96763165-96763187 CACTGGAGGGAAGCTTACGCTGG - Intronic
935437363 2:103049051-103049073 CTTTGCAGGGAGGCCGAGGCGGG - Intergenic
936772948 2:115936960-115936982 CTTTGGAAAGATGCTCAGGAGGG - Intergenic
936965040 2:118118976-118118998 CCATGGAGGGAAGCTTAGGTAGG + Intergenic
937109166 2:119349620-119349642 TTTTGGAGAGAAGCTGGGGCTGG - Intronic
937485861 2:122314191-122314213 CTTGGGAGGGAGGCTGAGGTGGG + Intergenic
938141354 2:128797273-128797295 CAGTGGCTGGAAGCTCAGGCAGG + Intergenic
938493736 2:131780194-131780216 CTTGGGAGGGAGGCTGAGGTGGG - Intergenic
938678169 2:133660011-133660033 CAATGGAAGGAGGCTCAGGCTGG + Intergenic
938879061 2:135566046-135566068 GTTGGGAGAGAAGCTGAGGCAGG - Intronic
939590175 2:144054754-144054776 CTCTGGAGGGCATCTCGGGCAGG - Intronic
940037344 2:149324538-149324560 GTTGGGAGAGAAGCTGAGGCAGG + Intergenic
940953414 2:159702930-159702952 CTCGGGAGGGAGGCTGAGGCAGG + Intergenic
942040627 2:172058621-172058643 CTTTGGAGGGCAGCTGATGTGGG - Intronic
942816130 2:180056529-180056551 GTTGGGAGGGAAACTGAGGCAGG + Intergenic
942816746 2:180061109-180061131 GTTGGGAGGGAAACTGAGGCAGG + Intergenic
943298969 2:186173458-186173480 GTTGGGAGGGAAACTGAGGCAGG - Intergenic
945100520 2:206258566-206258588 CTTAGTTGGGAAGCTGAGGCGGG + Intergenic
946818520 2:223606558-223606580 CATGGGAGGGAAGGGCAGGCAGG - Intergenic
947264234 2:228259259-228259281 ATTAGCAGGGAAGCTGAGGCAGG + Intergenic
947603546 2:231469122-231469144 CTCGGGAGGGAGGCTGAGGCAGG - Intronic
948144740 2:235699900-235699922 TTTTGGAGGCAACCTCAGGCTGG + Intronic
948234625 2:236379150-236379172 TGTTGGAGGGAAGCTCAGTGAGG - Intronic
948630659 2:239300638-239300660 TTCTGCAGGGAAGCTCAGCCTGG - Intronic
948660989 2:239506301-239506323 CTGTGGAGGGAAGGGCAGTCAGG + Intergenic
1169782233 20:9322057-9322079 CTCGGGAGGGAGGCTGAGGCAGG - Intronic
1169782463 20:9324061-9324083 CTCAGGAGGGAGGCTGAGGCAGG + Intronic
1169865395 20:10194772-10194794 CTCAGGAGGGAGGCTGAGGCAGG - Intergenic
1169904321 20:10585696-10585718 CTCAGGAGGGAGGCTGAGGCAGG - Intronic
1170215103 20:13883202-13883224 CTTTGCGGGTAAGCACAGGCTGG - Intronic
1171094316 20:22316785-22316807 CTCTTGAGGGAAACTCAGGATGG - Intergenic
1171240990 20:23566774-23566796 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
1171527416 20:25825855-25825877 CTTGGGAGAGTAGCTGAGGCAGG - Intronic
1171549410 20:26030029-26030051 CTTGGGAGAGTAGCTGAGGCAGG + Intergenic
1172043784 20:32064687-32064709 CACTGGATGGATGCTCAGGCAGG + Intronic
1172324474 20:34023830-34023852 CTTTGGAGGGGACCTCAGTGTGG + Intronic
1173823675 20:46034043-46034065 CTGGGAAGGGAAGCGCAGGCTGG - Intronic
1173868833 20:46329497-46329519 CCTTGGAGGGAAGGGCTGGCTGG + Intergenic
1174378519 20:50141763-50141785 CATTGCTGGGAAGCCCAGGCAGG - Intronic
1175330196 20:58158317-58158339 GTTTGGAGGGAAGCAGAGGCTGG - Intronic
1176614170 21:9014182-9014204 CTTGGGAGGGAGGCTGAGGTGGG + Intergenic
1177207712 21:18029651-18029673 TTTTGGGGGGAATCTCAGGGAGG + Intronic
1177501699 21:21964873-21964895 GTTGGGAGAGAAGCTGAGGCAGG - Intergenic
1177902873 21:26938130-26938152 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
1178151510 21:29799774-29799796 TTTGGGAGGGAGGCTAAGGCAGG - Intronic
1178411166 21:32364894-32364916 CTGTGGAGGGAAGGCAAGGCTGG + Intronic
1178517847 21:33263964-33263986 CTTGCGAGGGAGGCTGAGGCAGG - Exonic
1178539316 21:33435947-33435969 CTTGGTTGGGAAGCTGAGGCAGG + Intronic
1178721472 21:35014513-35014535 CTTTGGAGATAAGCTGAGCCCGG - Intronic
1179523455 21:41960160-41960182 CTTTGGAAGGAGGCCGAGGCAGG + Intergenic
1180100720 21:45583612-45583634 ATGGGGAGGGAAGCTCAGGGTGG - Intergenic
1180207298 21:46268924-46268946 CTGGGGAGGGAGGCTCAGGCAGG + Intronic
1180497939 22:15906244-15906266 CTTGGGAGGGAGGCTGAGGTGGG - Intergenic
1180606600 22:17063681-17063703 GTTGGGAGAGAAGCTAAGGCAGG + Intergenic
1180886536 22:19248795-19248817 TTTGGGAGGGAGGCTGAGGCAGG - Intronic
1181138099 22:20783503-20783525 CTGGGGAGGGAGGCTGAGGCAGG + Intronic
1181443534 22:22951229-22951251 TCATGGTGGGAAGCTCAGGCTGG - Intergenic
1181488553 22:23247077-23247099 TTTTGGAGGGATTGTCAGGCAGG - Intronic
1181594013 22:23902762-23902784 CTGTGGTGGGAAGCTCAGGGAGG - Intergenic
1181812908 22:25415066-25415088 GTTGGGAGAGAAGCTGAGGCAGG + Intergenic
1182284894 22:29240347-29240369 GTTGGGAGGGAAGCTGAGGCAGG + Intronic
1182492085 22:30679884-30679906 GTTGGGAGAGAAGCTGAGGCAGG - Intergenic
1183143466 22:35967066-35967088 CTTGGGAGGGAGGCTGAGGCAGG - Intronic
1183295771 22:37028602-37028624 CCTCGGGGGGAAGCTGAGGCAGG + Intronic
1183579326 22:38714230-38714252 CTTTGGTGGGAGGCCAAGGCGGG + Intronic
1184004561 22:41698814-41698836 TTTGGGAGGGAGGCTGAGGCAGG - Intergenic
1184382574 22:44155176-44155198 CTGTGGACAGAAGCTCAGGGAGG - Intronic
1184555284 22:45229460-45229482 CCGTGGAGGGGAGCTCAGGTGGG + Intronic
1185258162 22:49848216-49848238 GCCGGGAGGGAAGCTCAGGCCGG - Intergenic
950224232 3:11220610-11220632 CTGTGCAGGGAAGATCATGCTGG + Intronic
952884037 3:38002022-38002044 CTGGGGAGGGAAACTCAGGCAGG - Intronic
955939379 3:64133318-64133340 GCTTGATGGGAAGCTCAGGCCGG + Intronic
956130822 3:66052237-66052259 CTTGGGAGGGAGCCTGAGGCAGG + Intergenic
956611738 3:71130688-71130710 CTTTGTAGGCAACCTCAGGGAGG + Exonic
957047864 3:75390379-75390401 TTTGGGAGGGAGGCTGAGGCAGG + Intergenic
958024506 3:88035155-88035177 CTCGGGAGGGAGGCTAAGGCAGG - Intergenic
958263882 3:91414492-91414514 CTTAGTAGGGAGGCTGAGGCAGG - Intergenic
959008767 3:101050160-101050182 CTTTCCAGGGAAGCCCAGTCAGG - Intergenic
959239516 3:103771331-103771353 CTTTGGAAGGAGGCCAAGGCAGG - Intergenic
961127956 3:124438165-124438187 GTTTGGAGGGAAATTCAGCCTGG - Intronic
961383283 3:126509700-126509722 CTTTGGCGGGAAGGGCAGCCTGG - Intronic
961763492 3:129189562-129189584 CTTGGGAGGGAGGCTGAGGCAGG - Intergenic
961792904 3:129389402-129389424 GTTGGGAGAGAAGCTGAGGCAGG + Intergenic
962374194 3:134846745-134846767 CTCTGGTGGGATGCTCAGGTGGG + Intronic
963240995 3:143002101-143002123 CCTTGGAGGGAAACTGAGGGAGG - Intronic
963920431 3:150899853-150899875 TTTTGGAAGGAAGCACAGCCGGG - Intronic
964523824 3:157595730-157595752 CTTTGGAGGGGAGGGCAGGATGG - Intronic
964634469 3:158844469-158844491 TCTTGGAGGGAAGCCGAGGCGGG + Intergenic
965355533 3:167668469-167668491 CTTTGGAGGAAAGGTAAGACAGG + Intergenic
966889759 3:184398497-184398519 CTTTGGAAGGAAAAACAGGCTGG - Intronic
967037657 3:185660038-185660060 CTTTAAAGGGAGGCTGAGGCGGG - Intronic
967130886 3:186469732-186469754 CGATGGAGGGAAGCTGGGGCAGG - Intergenic
967135043 3:186505973-186505995 CTATGGGGGGAGGCTGAGGCAGG + Intergenic
967564090 3:190953242-190953264 GTTGGGAGAGAAGCTGAGGCAGG - Intergenic
968240140 3:197072802-197072824 CTCGGGAGGGAGGCTGAGGCAGG - Intronic
969111371 4:4846354-4846376 CTTTGTAGGGAAGACTAGGCAGG - Intergenic
969206413 4:5650322-5650344 GTTAGGAGGGAAGCGCAGGAAGG - Intronic
969823017 4:9734811-9734833 TTTGGGAGGGAGGCTGAGGCAGG - Intergenic
971330820 4:25680023-25680045 TTTGGGAGGGAGGCTGAGGCGGG + Intergenic
971384697 4:26132410-26132432 CTCTGGAAGGGAGCTCAGGTGGG - Intergenic
972172749 4:36366775-36366797 CTCAGGAGGGAGGCTAAGGCAGG - Intergenic
972320641 4:37970643-37970665 GGTAGCAGGGAAGCTCAGGCAGG - Intronic
974036515 4:56822503-56822525 CTTGGGAGGGAGGCTGAGGTGGG - Intergenic
975745678 4:77472249-77472271 CACAGGAGGGAAGCTCAGGCAGG - Intergenic
976565899 4:86550589-86550611 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
976629854 4:87225022-87225044 CTAAGGCGGGAAGCTAAGGCAGG - Intronic
979670051 4:123352147-123352169 ATTTATAGGGAAGCTCAGGGTGG - Intergenic
981276945 4:142911750-142911772 CTTTAGAGAGATGTTCAGGCAGG - Intergenic
982064257 4:151639289-151639311 CTTTGGACGGAAGTACAGGTGGG + Intronic
982554121 4:156839244-156839266 GTTGGGAGAGAAGCTGAGGCAGG - Intronic
983182296 4:164662664-164662686 GTTGGGAGGGAAACTGAGGCAGG + Intergenic
983409076 4:167373266-167373288 CTCGGGAGGGAGGCTGAGGCAGG + Intergenic
984720965 4:182972789-182972811 CTTAAGCGGGATGCTCAGGCAGG + Intergenic
984938766 4:184913089-184913111 GTTGGGAGGGAAACTGAGGCAGG - Intergenic
984947056 4:184977461-184977483 CTTGGGAGGGAGGCTGAGGCAGG + Intergenic
985091193 4:186364113-186364135 GTTGGGAGAGAAGCTGAGGCAGG + Intergenic
985601225 5:834368-834390 TTTTGTAGAGATGCTCAGGCTGG + Intronic
987008024 5:13730944-13730966 TTTGGGAGGGAGGCTGAGGCGGG - Intronic
987438616 5:17928790-17928812 CTGTGGCTGGAAGCCCAGGCTGG - Intergenic
987840111 5:23212532-23212554 CTCGGGAGGGAGGCTGAGGCAGG - Intergenic
987923037 5:24308367-24308389 GTTGGGAGAGAAGCTGAGGCAGG - Intergenic
988037908 5:25851790-25851812 CTTTGGAGAAAAGTTCAGCCGGG - Intergenic
988457447 5:31398959-31398981 GTTGGGAGGGAAACTGAGGCAGG - Intergenic
988605075 5:32672304-32672326 GTTGGGAGAGAAGCTGAGGCAGG - Intergenic
988790226 5:34601068-34601090 TTTGGGAGGGAAGCCGAGGCAGG + Intergenic
991359342 5:65803336-65803358 CATGGGAGGGAAGCTGAGGGGGG - Intronic
993477203 5:88380401-88380423 GTTGGGAGAGAAGCTGAGGCAGG + Intergenic
994282241 5:97919534-97919556 CTTTTGAGTGAAGATCAGTCTGG + Intergenic
995827021 5:116312017-116312039 CTTGGGAGGGAGGCTGAGGCAGG - Intronic
996798820 5:127379844-127379866 CTTTGGAAAGAAGCTGAGGTGGG - Intronic
997248945 5:132374106-132374128 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
997459174 5:134040613-134040635 CTGTGGAGGCAGGCTGAGGCAGG + Intergenic
998101825 5:139440744-139440766 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
998921112 5:147069490-147069512 TTGTGGAGGGAAGCAGAGGCAGG - Intronic
999179125 5:149656541-149656563 CTGTGGTGGGAGGCTGAGGCGGG - Intergenic
1000018374 5:157298441-157298463 CTTGGGAGGGAGGCTGAGGCAGG - Intronic
1000711969 5:164591501-164591523 CTCGGGAGGGAGGCTGAGGCAGG + Intergenic
1001028288 5:168242843-168242865 CTCAGGAGGGAGGCTGAGGCAGG + Intronic
1001712032 5:173786692-173786714 CTTTCGAGGGAAGCTCGGGGAGG + Intergenic
1003143887 6:3493646-3493668 GTGTGGAGGGAAGTACAGGCGGG + Intergenic
1005685823 6:28252249-28252271 CATAGGAGGGAAGTTGAGGCTGG + Intergenic
1006630689 6:35427768-35427790 CTTGGGAGGGAGGACCAGGCAGG - Exonic
1006849812 6:37090165-37090187 TTTGGGAGGGAGGCTGAGGCAGG + Intergenic
1007704037 6:43780449-43780471 CTTTGGTGGGAAGCCGAGACTGG - Intronic
1008015123 6:46509986-46510008 ACATGGAGTGAAGCTCAGGCAGG + Intergenic
1008991549 6:57608485-57608507 CTTAGTAGGGAGGCTGAGGCAGG + Intronic
1009180070 6:60506721-60506743 CTTAGTAGGGAGGCTGAGGCAGG + Intergenic
1009534347 6:64861193-64861215 CATGGGAGGGAATCTGAGGCAGG - Intronic
1012692729 6:102335141-102335163 CTTTGGAGAAGAGCTCAGCCGGG - Intergenic
1014055905 6:117014971-117014993 CTTGGGAAGGCAGCTAAGGCCGG - Intergenic
1014694086 6:124596924-124596946 CTTTGGACTTAAACTCAGGCTGG - Intronic
1014813768 6:125912761-125912783 GTTGGGAGGGAAACTGAGGCAGG - Intronic
1014935782 6:127383165-127383187 CTTTGCAGGGAGGCTGAGGCAGG + Intergenic
1014986817 6:128021526-128021548 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
1015257665 6:131198159-131198181 GTTAGGAGAGAAGCTGAGGCAGG - Intronic
1015663669 6:135603495-135603517 CATAGGAGGAAAGCTGAGGCAGG + Intergenic
1015971325 6:138745549-138745571 TTTGGGAGGGAGGCTGAGGCAGG - Intergenic
1016270949 6:142289846-142289868 TTTGGGAGGGAGGCTGAGGCGGG - Intergenic
1018048796 6:159989364-159989386 CTGTGGAAGGAAGCTCTGGGAGG + Intronic
1019054958 6:169216975-169216997 CTGGGGAAGGAAGCTCAGGCAGG + Exonic
1019085846 6:169476067-169476089 GTTGGGAGAGAAGCTGAGGCAGG + Intronic
1019812152 7:3172664-3172686 CTCTGGATGGAGGCTGAGGCAGG + Intronic
1020186178 7:5961067-5961089 CAGTGGGCGGAAGCTCAGGCAGG + Intronic
1020296737 7:6763703-6763725 CAGTGGGCGGAAGCTCAGGCAGG - Intronic
1020507809 7:9016720-9016742 GTTAGGAGGGAAACTGAGGCAGG + Intergenic
1021417177 7:20401084-20401106 CTTGGGAGGGAGGCTGAGGCAGG - Intronic
1021510195 7:21426662-21426684 CTTTGTAGGAAAGCTGAGGCAGG + Intergenic
1021781880 7:24114385-24114407 CTGTGCAGGTAAGGTCAGGCTGG - Intergenic
1023356476 7:39372025-39372047 CTTGGGAGGGAGGCTGAAGCAGG - Intronic
1023655858 7:42420420-42420442 CTTTGGTGGGAGGCCGAGGCAGG - Intergenic
1023910564 7:44552695-44552717 GTTGGGAGGGAAACTGAGGCAGG + Intergenic
1025023489 7:55497691-55497713 CTGTGGAGAGAGGCACAGGCTGG + Intronic
1025061249 7:55810584-55810606 CTCGGGAGGGAGGCTGAGGCAGG - Intronic
1025189234 7:56884069-56884091 CATTGGATGGAAGCTGAGACTGG + Intergenic
1025298233 7:57794010-57794032 CTTGGGAGAGTAGCTGAGGCAGG + Intergenic
1025682706 7:63692848-63692870 CATTGGATGGAAGCTGAGACTGG - Intergenic
1025874975 7:65472700-65472722 CTTTGGGAGGAGGCTGAGGCAGG - Intergenic
1026487034 7:70830413-70830435 CTTTGAGGGGACGCTGAGGCGGG + Intergenic
1026698885 7:72621375-72621397 CCGTGGTGAGAAGCTCAGGCTGG - Intronic
1026809186 7:73448006-73448028 CCTTAGAAGGAAGCCCAGGCCGG + Intronic
1027154164 7:75754681-75754703 CTCGGGAGGGAGGCTGAGGCAGG + Intergenic
1027543623 7:79499703-79499725 GTTTGGAGGGAGGCTGAGGCTGG - Intergenic
1028308230 7:89293675-89293697 CTTGGGAGGGAGGCTGAGGCAGG + Intronic
1029035938 7:97521562-97521584 CTTGGAGGGGAAGCTGAGGCAGG + Intergenic
1029228202 7:99044063-99044085 CTGGGGAGGGAAGCCAAGGCGGG + Intronic
1029432502 7:100539950-100539972 CTTTAGAGGGAACTTCATGCAGG + Intronic
1029482988 7:100824154-100824176 CTCTGGAGGGAAACTGAGGGAGG - Intronic
1029665039 7:101989615-101989637 CATTGGATGGAAGCTGAGACTGG + Intronic
1029899260 7:104022293-104022315 CGTAGGAGGGAAGCTGAGGTGGG + Intergenic
1030091461 7:105862325-105862347 CTTGGGAGGGAGGCTGAGGTGGG + Intronic
1030681702 7:112441026-112441048 CTTTGGTGGGAGGCTGAGGAGGG + Intronic
1031528112 7:122845840-122845862 CTTTGGATGGAATCTCAGATTGG - Intronic
1032555932 7:132835080-132835102 CTGGGGAGGGAGGCTCAGGTGGG - Intronic
1033065106 7:138146388-138146410 AGTTGGGGGGAGGCTCAGGCAGG - Intergenic
1033085645 7:138339215-138339237 GTTGGGAGAGAAGCTGAGGCAGG + Intergenic
1033086359 7:138345537-138345559 GTTGGGAGAGAAGCTGAGGCAGG + Intergenic
1033346846 7:140532155-140532177 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
1033370334 7:140701514-140701536 CTTGGGAGGGAGGCTGAGGCAGG + Intronic
1034001036 7:147413522-147413544 CTGGAGATGGAAGCTCAGGCAGG + Intronic
1034241236 7:149612741-149612763 GTTGGGAGGGAAGCTGAGGCAGG + Intergenic
1034615899 7:152416435-152416457 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
1035493486 7:159300292-159300314 CTTTGCAGGGAAGCAAATGCTGG + Intergenic
1035564972 8:635368-635390 CTTTGGAGGGAAGCTCAGGCTGG - Intronic
1035796288 8:2360299-2360321 CTCGGGAGGGAGGCTGAGGCAGG - Intergenic
1036810612 8:11865905-11865927 CTTGGGAGGGAGGCTGAGACAGG + Intronic
1037315535 8:17595874-17595896 CTTTTGAGGGAGGGGCAGGCAGG + Intronic
1037941633 8:22955929-22955951 CTTTGGGGGGAAGCTCCAGGAGG - Intronic
1038826685 8:31010305-31010327 CTAAGGTGGGAAGCTCAGGCAGG + Intronic
1039541692 8:38377593-38377615 TTTGGGAGGGAGGCTGAGGCGGG - Intronic
1040571683 8:48616912-48616934 CCTTGGAGGGAAGCTCACACAGG + Intergenic
1041659443 8:60387101-60387123 CTTTGGGAGGAGGCTGAGGCGGG - Intergenic
1041688560 8:60667261-60667283 CTTGGGAGGGGAACTGAGGCTGG - Intergenic
1041899488 8:62965448-62965470 CTCTGGAAGGAATGTCAGGCGGG - Intronic
1042695051 8:71547221-71547243 ATCTGGAGGGCAGCCCAGGCAGG - Intronic
1044444921 8:92264637-92264659 CTTGGGAGGGAGGCTAAGGTGGG + Intergenic
1046248364 8:111595941-111595963 CATTGGCTGAAAGCTCAGGCAGG + Intergenic
1046944228 8:119959636-119959658 CTGTGGTGGGAGGCTGAGGCAGG - Intronic
1047070303 8:121335640-121335662 CTTTGGAGGAAAGCTTTGGGTGG + Intergenic
1047774326 8:128057096-128057118 AATGGGAGGGAAGCTCAGGGTGG - Intergenic
1048081976 8:131138297-131138319 CTCGGGAGGGAGGCTGAGGCGGG + Intergenic
1048703951 8:137128606-137128628 CTCAGGAGGGAGGCTGAGGCAGG + Intergenic
1048854977 8:138679025-138679047 CTATGGAGGGAGGCTGAGGCAGG - Intronic
1049116539 8:140693447-140693469 CTCTGGAAGGAGGCTGAGGCAGG + Intronic
1050379795 9:5016092-5016114 ATTTGGAGGGAAGCGACGGCTGG - Intronic
1051924333 9:22305446-22305468 CTTGGCAGGGAAGCTCAGAGAGG + Intergenic
1052318275 9:27139099-27139121 CTCCGGAGGGAGGCTGAGGCAGG + Intronic
1052405776 9:28059081-28059103 GTTGGGAGGGAAACTGAGGCAGG + Intronic
1052538268 9:29775878-29775900 GTTGGGAGGGAAACTGAGGCAGG - Intergenic
1052834190 9:33238283-33238305 CTTTGGGAGGAGGCTGAGGCGGG - Intronic
1054149811 9:61592862-61592884 CTTGGGAGAGTAGCTGAGGCAGG + Intergenic
1054469575 9:65523963-65523985 CTTGGGAGAGCAGCTGAGGCAGG + Intergenic
1054760995 9:69003842-69003864 CCCTGGAGGGGAGCCCAGGCAGG - Intronic
1056459886 9:86799505-86799527 CTTGGGAGGGAAGGCCTGGCTGG + Intergenic
1056580678 9:87886533-87886555 CTTTGCAGGGAAGGGCAGGAAGG + Exonic
1056716449 9:89034859-89034881 GTTGGGAGGGAAACTGAGGCAGG + Intronic
1056847609 9:90054421-90054443 CTTTGGAGGCAGGGTCTGGCTGG + Intergenic
1057207406 9:93181964-93181986 CTCTGCAAGGAATCTCAGGCTGG - Intergenic
1057977534 9:99622180-99622202 CTTAGGAAGGAAGCTCATGCTGG + Intergenic
1057996152 9:99822897-99822919 CTCTGGAAGGAAGCTTAGGAGGG + Intronic
1058648408 9:107152315-107152337 CTGTTTAGGGAAGCACAGGCAGG - Intergenic
1058854523 9:109048043-109048065 CTTAGGAGGGAAGCTATAGCTGG + Intronic
1059457936 9:114411593-114411615 CTTTCCAGGGAAGCTCAGGGAGG + Intronic
1060377853 9:123133783-123133805 CTTTGAAAGGAAGCTGAGGTGGG - Intronic
1060991393 9:127851464-127851486 TTTGGGAGGGAGGCTGAGGCGGG - Intronic
1061017482 9:127990323-127990345 CTTGGGAGGGAGGCTGAGGCAGG + Intergenic
1061471323 9:130828309-130828331 CTTTGGGGGGAGGCTGAGGCAGG - Intronic
1062218210 9:135400372-135400394 ATTGGGAGGGAAACTGAGGCAGG - Intergenic
1185445392 X:255154-255176 CCTCGGTGGGAAGCTCGGGCAGG + Intergenic
1185594799 X:1299527-1299549 CTCTGTAGGGAGGCTGAGGCAGG - Intronic
1186812103 X:13200364-13200386 GTTTGGAGCCAAGCTCAGGGTGG - Intergenic
1188931621 X:36118579-36118601 CTCAGGAGGGAGGCTGAGGCAGG - Intronic
1189375567 X:40463966-40463988 CTTGGGTGGGAGGCTGAGGCAGG - Intergenic
1189424164 X:40882947-40882969 CCTTGGGGGGAAGGTCAGCCTGG - Intergenic
1189804496 X:44721636-44721658 ATTTGCAGGGGAGCTGAGGCAGG + Intergenic
1190271561 X:48868047-48868069 CTATGGAGGGGAGGACAGGCAGG - Intergenic
1190805636 X:53833629-53833651 CTTGGGAGGGAGGCTGAGGCAGG + Intergenic
1192105404 X:68311161-68311183 GGTTGGAGGGAAGTTGAGGCTGG + Intronic
1192816676 X:74600910-74600932 CTTGGGAGGGAGGCTGAGGCAGG + Intronic
1192822508 X:74659372-74659394 GTTGGGAGGGAAACTGAGGCAGG - Intergenic
1193237812 X:79130573-79130595 CTCGGGAGGGAGGCTGAGGCAGG + Intergenic
1193565126 X:83066330-83066352 GTTGGGAGAGAAGCTGAGGCAGG - Intergenic
1193758321 X:85436031-85436053 TTTGGGAGAGAAGCTCAAGCAGG + Intergenic
1195059832 X:101183550-101183572 GTTGGGAGAGAAGCTGAGGCAGG - Intergenic
1196742082 X:119033957-119033979 GTTGGGAGAGAAGCTGAGGCAGG + Intergenic
1197764787 X:130053026-130053048 GTTACGAGGGAAGCTGAGGCAGG + Intronic
1197945432 X:131833775-131833797 CTTTTTAGGGAGGCTGAGGCAGG + Intergenic
1200377927 X:155803783-155803805 GTTGGGAGAGAAGCTGAGGCAGG - Intergenic
1200395843 X:155987209-155987231 GTTGGGAGAGAAGCTGAGGCAGG - Intergenic
1201264504 Y:12193110-12193132 GTTGGGAGAGAAGCTGAGGCAGG - Intergenic
1201279322 Y:12327450-12327472 GTTGGGAGAGAAGCTGAGGCAGG + Intergenic