ID: 1035564973

View in Genome Browser
Species Human (GRCh38)
Location 8:635372-635394
Sequence GGGACTTTGGAGGGAAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 1, 2: 2, 3: 20, 4: 245}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035564973_1035564984 20 Left 1035564973 8:635372-635394 CCTGAGCTTCCCTCCAAAGTCCC 0: 1
1: 1
2: 2
3: 20
4: 245
Right 1035564984 8:635415-635437 ACAATAGTGACAGCTAAGGCTGG No data
1035564973_1035564983 16 Left 1035564973 8:635372-635394 CCTGAGCTTCCCTCCAAAGTCCC 0: 1
1: 1
2: 2
3: 20
4: 245
Right 1035564983 8:635411-635433 ACTAACAATAGTGACAGCTAAGG No data
1035564973_1035564985 30 Left 1035564973 8:635372-635394 CCTGAGCTTCCCTCCAAAGTCCC 0: 1
1: 1
2: 2
3: 20
4: 245
Right 1035564985 8:635425-635447 CAGCTAAGGCTGGCTGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035564973 Original CRISPR GGGACTTTGGAGGGAAGCTC AGG (reversed) Intronic
900316001 1:2056584-2056606 GGGTCTGTGGTGGGCAGCTCTGG + Intronic
901278656 1:8013736-8013758 GGAACTCTGGGGGGAACCTCAGG + Exonic
902641156 1:17767196-17767218 GGGACTGTGGAGGCCTGCTCTGG + Intronic
903044679 1:20555762-20555784 GGGGCTTTGGAGGGAAAAGCTGG + Intergenic
904425833 1:30422422-30422444 GGGACTGAGGAGAGAGGCTCAGG + Intergenic
906070780 1:43014932-43014954 GGGACTCAGGTGGGAAGCTTGGG + Intergenic
906303043 1:44697645-44697667 GGGACTTTCTTGGGAAGCTGTGG - Intronic
906530197 1:46519577-46519599 GGGAATTTGGAGAGAAGCTTCGG - Intergenic
907529532 1:55080308-55080330 GGGACATTGGAGGAACACTCAGG - Intronic
910344251 1:86217473-86217495 GGGACTCAGGAGGGAAGATGGGG + Intergenic
912550004 1:110479388-110479410 GGGCCTCAGGAGGGAACCTCAGG - Intergenic
913497277 1:119440057-119440079 GAGCCTCTGGAAGGAAGCTCTGG - Intergenic
915268197 1:154733627-154733649 GGGGGTCTGGAGGGAAGCTGTGG + Intronic
920059192 1:203215957-203215979 GGGACTTGGGAAGGCAGCTGGGG - Intronic
921099840 1:211919373-211919395 GTGACTTTTGGGGAAAGCTCTGG - Intergenic
922134950 1:222815290-222815312 GGGACTGAGGAGGGAGGCACCGG + Intergenic
922986724 1:229871701-229871723 GGGGAGTTGGAGGGGAGCTCTGG + Intergenic
924250817 1:242131385-242131407 GGGACTTTGGTGGGAGGGTTTGG + Intronic
924455923 1:244218915-244218937 GGGACCCTGGAGGGAAGTCCTGG - Intergenic
924610689 1:245571269-245571291 GGGGCTTGGGAGGGGAGCCCCGG - Intronic
1067249847 10:44576988-44577010 TGGGTTGTGGAGGGAAGCTCAGG - Intergenic
1067567322 10:47348770-47348792 GGGACTTGTGGGGGAGGCTCGGG - Exonic
1069944996 10:71979460-71979482 GGGAAGTCGGAGGGAGGCTCTGG + Intronic
1073242897 10:102069691-102069713 AGGACTTTGGAAGACAGCTCAGG + Intergenic
1073432427 10:103494780-103494802 GGGAGTGAGGAGGGAAGCTTGGG + Intronic
1075545930 10:123354662-123354684 GAGACTTGGTAAGGAAGCTCGGG + Intergenic
1075826626 10:125362362-125362384 GGGATTGTGGAGGGATCCTCTGG + Intergenic
1076611204 10:131726981-131727003 GGGACGTTGGAGGGCAGTGCGGG - Intergenic
1077471906 11:2767699-2767721 GGCACTGTGGAGAGAAGCTTTGG - Intronic
1078356524 11:10635965-10635987 GGGACATGGAAGGGAAGCTTGGG + Intronic
1078435878 11:11325348-11325370 GGGACTTAGCAGGGAAGGTTGGG + Intronic
1079350125 11:19685143-19685165 GGGCCTTCTGAGGGAAGGTCTGG - Intronic
1079407530 11:20159251-20159273 AGGTCTTGGGAGGGACGCTCTGG + Exonic
1080414919 11:32060533-32060555 GGTACTTAGGAGGGAGGCTGAGG + Intronic
1083786296 11:64949953-64949975 GGCAGTTTGGAGGGTAGGTCAGG - Intronic
1084296451 11:68215680-68215702 GGGGCTCTGGAGGGCTGCTCAGG - Intergenic
1084593649 11:70104772-70104794 GGGACTTTGGATGGAAGCTCTGG + Intronic
1084703213 11:70801138-70801160 GGGAGTTTGGAAGGAAAGTCAGG - Intronic
1084786615 11:71445460-71445482 GGGCCTTGGCAGGGAAGCTGGGG - Intronic
1089883100 11:121793886-121793908 GGGACTTTGGGTGGGGGCTCGGG + Intergenic
1091564137 12:1635606-1635628 GTGGCTATGGAGGGTAGCTCGGG + Intronic
1095907570 12:47393549-47393571 GGGATGTTGGAATGAAGCTCTGG - Intergenic
1096817379 12:54210137-54210159 GAGACTCTGGAGGGAAGAGCAGG + Intergenic
1097418009 12:59337728-59337750 GGGATTTTCGAGGGAAGGGCTGG + Intergenic
1097922672 12:65093167-65093189 AGGTCTTTGGATGGATGCTCAGG - Intronic
1099887502 12:88549699-88549721 TGGACTTAGGAGGGAAACTTGGG + Intronic
1101067954 12:101042336-101042358 GGTACTTTGGAGAGAAGATTGGG + Exonic
1101327072 12:103724812-103724834 GGGAATTGGAAGGCAAGCTCAGG + Intronic
1101428092 12:104604238-104604260 GGGACTTGGGAGGGAAACTAGGG + Intronic
1101839840 12:108320340-108320362 GGGCTTGGGGAGGGAAGCTCAGG - Intronic
1101840169 12:108322269-108322291 GGGCTTGGGGAGGGAAGCTCAGG + Intronic
1102522932 12:113490452-113490474 GGGCCTTTGGATGGAAGCTCTGG + Intergenic
1103401776 12:120648112-120648134 GGGACCCCAGAGGGAAGCTCAGG - Intronic
1103931128 12:124451657-124451679 GTGACTATGGTGGGAAGATCAGG + Intronic
1104811667 12:131623357-131623379 GGGACTCTGCAGGGAAACGCAGG + Intergenic
1104958489 12:132477190-132477212 AGGGCTGGGGAGGGAAGCTCAGG - Intergenic
1105411285 13:20173884-20173906 TGAACTGTGGAGGGGAGCTCGGG - Intergenic
1111411783 13:87886798-87886820 CTGACCATGGAGGGAAGCTCTGG + Intergenic
1113216947 13:108052814-108052836 TGGAATTTAGAGGAAAGCTCTGG + Intergenic
1113832212 13:113304903-113304925 AGCACTTTGGTGGGAAGCTGAGG - Intronic
1119774561 14:77240325-77240347 GGGACTTTGGAGGCCAGCCAGGG + Intronic
1120744685 14:88142813-88142835 GGGAAGTTGGAGGAGAGCTCTGG + Intergenic
1121912144 14:97801506-97801528 GGGAAGTTGGAGGGAAGTCCTGG + Intergenic
1121924454 14:97915259-97915281 GTGACTTTGGAAGGAAGGCCTGG - Intergenic
1122358021 14:101135916-101135938 GGGACTTTGGGGGCCAGGTCTGG + Intergenic
1122363495 14:101181207-101181229 GGGACTTAGCAGGGAAGAGCTGG - Intergenic
1122646239 14:103196323-103196345 GGGAGTTGGGAGGAAAGATCCGG + Intergenic
1123064090 14:105607359-105607381 GGGACGCTGGAGGCAAGCGCTGG + Intergenic
1123073401 14:105653002-105653024 GGGACGCTGGAGGCAAGCGCTGG + Intergenic
1123093328 14:105751769-105751791 GGGACGCTGGAGGCAAGCGCTGG + Intergenic
1123121809 14:105920230-105920252 GGGTCTGTGGAGTGAAGATCTGG + Intronic
1125001673 15:34777404-34777426 AGGACTTTGGTGGGATGGTCTGG - Intergenic
1127221623 15:56886929-56886951 CGGACTAGGGAGTGAAGCTCTGG - Intronic
1127587225 15:60390028-60390050 GGGACTATGTAGGGAAGATGAGG - Intronic
1127704902 15:61536889-61536911 GGGACTTTGAAGAGGAGCTGGGG - Intergenic
1129267518 15:74401902-74401924 GGGACTCTGGTGGGGATCTCTGG - Intergenic
1130024869 15:80262251-80262273 GGGACTTTGGAGGGAGGCAGTGG + Intergenic
1130135445 15:81177947-81177969 GGGACTTTGGTGGGAAGATCAGG - Intronic
1130238674 15:82164442-82164464 GGGAGTATGGAGGGTAGCTTAGG - Intronic
1132655544 16:1040450-1040472 GGGACCCTGGCGGGAACCTCGGG - Intergenic
1132655579 16:1040546-1040568 GGGACCTCGGGGGGAACCTCGGG - Intergenic
1132655593 16:1040571-1040593 GGGACCTCGGGGGGAACCTCGGG - Intergenic
1132682377 16:1148380-1148402 GGACCTGGGGAGGGAAGCTCCGG - Intergenic
1132977027 16:2716054-2716076 GAGACTTTGGGGGGCAGCTGGGG - Intronic
1132981667 16:2741376-2741398 GGGCCCCTCGAGGGAAGCTCTGG + Intergenic
1133369132 16:5234728-5234750 GGGACATTGGAGGCAAGGGCTGG - Intergenic
1134166192 16:11931679-11931701 CTGACTCTGGAGGGAAGCTAAGG + Intronic
1134494528 16:14722046-14722068 CTGACTCTGGAGGGAAGCTAAGG - Intronic
1134499909 16:14761166-14761188 CTGACTCTGGAGGGAAGCTAAGG - Intronic
1134545950 16:15108561-15108583 CTGACTCTGGAGGGAAGCTAAGG + Intronic
1134580670 16:15367884-15367906 CTGACTCTGGAGGGAAGCTAAGG + Intronic
1134714031 16:16346258-16346280 CTGACTCTGGAGGGAAGCTAAGG - Intergenic
1134721903 16:16389621-16389643 CTGACTCTGGAGGGAAGCTAAGG - Intronic
1134945522 16:18322248-18322270 CTGACTCTGGAGGGAAGCTAAGG + Intronic
1134952786 16:18362400-18362422 CTGACTCTGGAGGGAAGCTAAGG + Intergenic
1135311582 16:21409104-21409126 CTGACTCTGGAGGGAAGCTAAGG + Intronic
1135364534 16:21841556-21841578 CTGACTCTGGAGGGAAGCTAAGG + Intronic
1135447309 16:22529793-22529815 CTGACTCTGGAGGGAAGCTAAGG - Intronic
1136150747 16:28347013-28347035 CTGACTCTGGAGGGAAGCTAAGG + Intronic
1136166984 16:28460851-28460873 CTGACTCTGGAGGGAAGCTAAGG + Intronic
1136195992 16:28654181-28654203 CTGACTCTGGAGGGAAGCTAAGG - Intronic
1136212330 16:28768304-28768326 CTGACTCTGGAGGGAAGCTAAGG - Intronic
1136257053 16:29048216-29048238 CTGACTCTGGAGGGAAGCTAAGG - Intronic
1136308287 16:29388100-29388122 CTGACTCTGGAGGGAAGCTAAGG + Intronic
1136321704 16:29489638-29489660 CTGACTCTGGAGGGAAGCTAAGG + Intronic
1136371776 16:29841232-29841254 GGCAGTTTGGAGGGCACCTCGGG - Intronic
1136436384 16:30229608-30229630 CTGACTCTGGAGGGAAGCTAAGG + Intronic
1139291186 16:65859311-65859333 GTGACATTGGAGTGAAGATCTGG - Intergenic
1139292968 16:65874617-65874639 GGGACTTGAGATGAAAGCTCAGG + Intergenic
1139855983 16:69980528-69980550 CTGACTCTGGAGGGAAGCTAAGG + Intergenic
1140366744 16:74387551-74387573 CTGACTCTGGAGGGAAGCTAAGG - Intronic
1141685077 16:85565557-85565579 GGGTCCCTCGAGGGAAGCTCTGG + Intergenic
1142939187 17:3367364-3367386 GGGACTTGGGAGGGAAGGGTGGG - Intergenic
1143063511 17:4223584-4223606 GGGCCTTTGGAGTGATGCTGTGG + Intronic
1143653076 17:8276256-8276278 GTGACTTTTAGGGGAAGCTCAGG + Intergenic
1143677287 17:8443700-8443722 GGGCTTTTGGAAGGAAGCTTTGG + Intronic
1143845956 17:9772742-9772764 GAGACTTCAGAGGGAAGCTGGGG - Intronic
1144453984 17:15404173-15404195 GGTATTTTGGATGGCAGCTCTGG + Intergenic
1144952460 17:19001648-19001670 GGGACTTTTGTGGGAAGCAAAGG + Intronic
1150596982 17:66615044-66615066 GGGACTGTGCATGGAAGCCCTGG - Intronic
1152852878 17:82648127-82648149 GGGGCTTCGGAGGGGAGCTCGGG + Intronic
1153520823 18:5952432-5952454 GGGGCTTTGGAGTGAGGCCCAGG - Intergenic
1153552258 18:6273855-6273877 GGAACTTCGGAGTGAAGATCTGG + Intronic
1154117454 18:11623736-11623758 CTGACTCTGGAGGGAAGCTAAGG + Intergenic
1155162721 18:23208691-23208713 GGCACCTTGTAGGGAAGCCCTGG - Intronic
1155320394 18:24613119-24613141 GGGACACTGGATGGAAGCTGAGG - Intergenic
1156327547 18:36087755-36087777 GGGACTGTTGGGGGAAGGTCAGG + Intergenic
1162162516 19:8729238-8729260 GGGACTTCAGAGGGAAGCAAGGG - Intergenic
1163750732 19:19075899-19075921 GGGACTTTTGAGGGAACCATCGG - Intronic
1164526463 19:29016939-29016961 GGGAAGTGGGAGGGAAGCTTGGG + Intergenic
1164565572 19:29323696-29323718 GGGCCTCCGGTGGGAAGCTCCGG + Intergenic
1165345763 19:35248247-35248269 GGGACTTTAGAGGGTTCCTCAGG + Intergenic
1165845731 19:38816634-38816656 GGGACTTTGGAGGAAGTCACTGG - Intronic
1167245386 19:48370039-48370061 GGGAGGATGGACGGAAGCTCAGG + Intronic
1167410852 19:49342856-49342878 GGGTCTTTGGAGGGTATCTGAGG - Intronic
1168239095 19:55080409-55080431 GGGACCTGGGAAGGAAGTTCTGG + Intronic
1168428041 19:56255336-56255358 GGGAGTGGGGAGGGAAGCTATGG + Intronic
1168531788 19:57136064-57136086 GGGACATTGGAGGGCAGATTTGG - Exonic
1168714207 19:58517808-58517830 GGGACTGTGAAGGGCAGCTGGGG - Intronic
925806480 2:7655459-7655481 GAGACTTTGCTGGGAACCTCAGG - Intergenic
927494760 2:23544948-23544970 GGGACTTGGGAGAGATGATCTGG + Intronic
928426966 2:31187362-31187384 GGGTCATTGGAGGGGAGCGCAGG - Intronic
928712515 2:34023187-34023209 AGGATTTTGGAGGGAAGCAATGG + Intergenic
930256782 2:49102279-49102301 GGGACTTTGCTGGGAAGGTGTGG + Intronic
935843057 2:107134495-107134517 GGGACTTTGCAGGGCCGCTTTGG - Intergenic
935882543 2:107580078-107580100 GTGATTTAGGAGGGAAGATCAGG + Intergenic
936240247 2:110781702-110781724 GGTCTTTTGGAGGGAAGGTCAGG + Intronic
937109167 2:119349624-119349646 GGGATTTTGGAGAGAAGCTGGGG - Intronic
942673436 2:178401731-178401753 GAATCTTTGGAGGGAAACTCAGG - Intergenic
943106138 2:183546780-183546802 GGGGGTTTGGGGGGAGGCTCAGG + Intergenic
943576646 2:189638346-189638368 GGGACTTGGCAGGGAAACTGAGG - Intergenic
946663493 2:222026312-222026334 GGGACTTCTGTGGGAAGCTGTGG - Intergenic
947085137 2:226442752-226442774 GGGACTATGGAGGGAAGGTTGGG + Intergenic
947713785 2:232330077-232330099 GGGACTCTGGGGGGAAGCAGAGG - Intronic
947744512 2:232500699-232500721 GAGAATGGGGAGGGAAGCTCAGG - Intergenic
947792813 2:232877435-232877457 GGGCCTTTGGAGGGAAGGGTTGG + Intronic
948874196 2:240818649-240818671 GAGGGTTTGAAGGGAAGCTCTGG - Intronic
948903203 2:240966369-240966391 GGGACTTTGTGCAGAAGCTCCGG + Intronic
1169303770 20:4470457-4470479 GTCACTCTGGAGGAAAGCTCTGG - Intergenic
1173845070 20:46182986-46183008 GGCACTCTGGATGGCAGCTCTGG + Intronic
1174109840 20:48191378-48191400 GGGACATGGGAGGGAACTTCTGG - Intergenic
1174703488 20:52633017-52633039 AGGACTTTGGTGGGAACCTGGGG + Intergenic
1174992925 20:55533682-55533704 CAGCCTATGGAGGGAAGCTCTGG + Intergenic
1175330197 20:58158321-58158343 GGAAGTTTGGAGGGAAGCAGAGG - Intronic
1177438123 21:21082646-21082668 GGTACTTTGGAGGTAACCTGAGG + Intronic
1178675857 21:34631277-34631299 AAGACTTTGGAGGGCAACTCTGG + Intergenic
1179319582 21:40277165-40277187 GGGACTTGAGGGGAAAGCTCTGG + Intronic
1179421836 21:41242444-41242466 CGGCCCCTGGAGGGAAGCTCAGG - Intronic
1179500397 21:41805101-41805123 GGGCCATTGGAGGGAAGGTAGGG - Intronic
1180699138 22:17772378-17772400 GGGGCTGTGGAGGGCAGCACAGG - Intronic
1181939326 22:26463312-26463334 GGGGCTATGGAGGGAAACACTGG + Intronic
1182316325 22:29449674-29449696 GGGTCTGTGGGGGGAAGCGCTGG + Intergenic
1182519873 22:30879181-30879203 GGGACAAGGGAGGGCAGCTCCGG - Intronic
1182547034 22:31082389-31082411 GGCACTTTGGAAGGGAGCTTCGG + Intronic
1183089928 22:35515135-35515157 GTGAATTTGGAGGGAGGGTCGGG + Intergenic
1184976457 22:48065887-48065909 GGGAATATAGAGGGAAGCTGGGG + Intergenic
950509794 3:13419537-13419559 GGAGTTTTGGAGGGAAGCCCAGG - Intronic
950558002 3:13706705-13706727 GGGGCTTTGGGAGGAAGCTGAGG + Intergenic
952411267 3:33052057-33052079 GGGGCATTGCAGGGAAGCCCTGG - Intronic
952415993 3:33092162-33092184 GGGCCTTTGGGGGCAAGGTCAGG - Exonic
952426914 3:33185027-33185049 GGGAATGTGGTGGGAAGCTGTGG + Intronic
952884038 3:38002026-38002048 GGGACTGGGGAGGGAAACTCAGG - Intronic
953287391 3:41625505-41625527 AGTACTTTGGAGAGCAGCTCCGG + Intronic
955322701 3:57985722-57985744 TGGACTTTGGCTGGAAGTTCTGG + Intergenic
955545241 3:60021284-60021306 CGGAGTTTTGAGGGCAGCTCAGG - Intronic
955749790 3:62176211-62176233 TGGACTTTGGAGGAGAGCTTTGG + Intronic
955939378 3:64133314-64133336 GGGAGCTTGATGGGAAGCTCAGG + Intronic
957321422 3:78635849-78635871 GGGACTCTGGCGAGAAGCACTGG - Exonic
959682495 3:109111751-109111773 GGAACTTTGGAGAGACGCTCAGG - Intronic
960036287 3:113105840-113105862 GGGACTGGGGAGGGAAGCATGGG - Intergenic
962293587 3:134159350-134159372 GGGCCTTTGGAGTGACGCTGTGG - Exonic
963786770 3:149542634-149542656 AGTACTTTGGAAGGAATCTCAGG - Intronic
965510725 3:169565659-169565681 AGGACTTTGCAGGAAATCTCTGG + Intronic
967101670 3:186221119-186221141 GGGCCTTTGGAGAGACTCTCTGG - Intronic
969652143 4:8474207-8474229 GGGGAGTTGGGGGGAAGCTCTGG + Intronic
970375349 4:15451504-15451526 GGGACTTAGGAGGGACACTGTGG - Intergenic
970694406 4:18660060-18660082 GTGACTTTTGGGGGCAGCTCTGG + Intergenic
970865134 4:20749651-20749673 GTGAGTTTCGAGGTAAGCTCTGG - Exonic
971514272 4:27467206-27467228 TGAACCTTGGAGGGAAGCTGAGG + Intergenic
976509820 4:85895043-85895065 GGGACTCACGAGGGAAGATCGGG + Intronic
976778213 4:88729677-88729699 GGGACTTAGGAGATAAGCTCTGG - Intronic
979406506 4:120317903-120317925 GAGACATTTGAAGGAAGCTCTGG + Intergenic
985563506 5:603747-603769 GGGGCTGCGGAGGGGAGCTCTGG - Intergenic
985770693 5:1808316-1808338 CGTATTTGGGAGGGAAGCTCAGG - Intronic
986093005 5:4529230-4529252 GGGACTTTGGGGAGACTCTCAGG + Intergenic
987075572 5:14379095-14379117 GGGGGTCTGGAGGGAAGCACAGG + Intronic
989382012 5:40818496-40818518 GGGACTTATCAGGGAAGTTCAGG - Intergenic
993354470 5:86888870-86888892 GAGACTTTAGAGGGATGCTAAGG + Intergenic
995092445 5:108194108-108194130 GGGCCTTGATAGGGAAGCTCTGG - Intronic
995522690 5:113025958-113025980 GGAACTTTGGATGGATTCTCTGG + Intronic
995827022 5:116312021-116312043 GGTACTTGGGAGGGAGGCTGAGG - Intronic
997238696 5:132291602-132291624 GGCACTTTGGGAGGAAGCTGAGG + Intronic
997872479 5:137517482-137517504 GGGATTATGGAGGCAAGCTCAGG + Intronic
1000139049 5:158383436-158383458 GGCAGTGTGGAGGGAAGCTCTGG + Intergenic
1001046398 5:168375445-168375467 CTGACTTTGGAGGGCAGCTTTGG + Intronic
1003570743 6:7254899-7254921 GGGACTGTGGAAGGAACCTCTGG - Intergenic
1005925612 6:30442822-30442844 TGGACTTTGGAAGAAAGCTTCGG + Intergenic
1006423556 6:33950086-33950108 GGGGCTGCGGCGGGAAGCTCTGG - Intergenic
1006679848 6:35788987-35789009 GGGAGTTTGGAGGTAAACTATGG + Intronic
1006780711 6:36630579-36630601 AGGATTTTGGAGGTAAGCCCAGG - Intergenic
1007843285 6:44734093-44734115 GGGACATGGGAGAGAAGCTCTGG + Intergenic
1008161321 6:48079580-48079602 GGGACTTTGTAGGGAGGGTTTGG + Intergenic
1009264136 6:61532226-61532248 GGGAATCTGGAGGGAAAGTCTGG - Intergenic
1012239505 6:96856182-96856204 GGGACTTGGGAGGGAAGGGTGGG - Intergenic
1018048794 6:159989360-159989382 TGCACTGTGGAAGGAAGCTCTGG + Intronic
1019009086 6:168826695-168826717 GGGACATTGGAAGGAAGCTAAGG + Intergenic
1020129176 7:5549812-5549834 GAGACTTTGGTGGGGAGGTCTGG + Intronic
1021510194 7:21426658-21426680 AGGACTTTGTAGGAAAGCTGAGG + Intergenic
1021599325 7:22348973-22348995 GGTACTTGGGAGGGAGGCTGAGG + Intronic
1021907751 7:25352487-25352509 GGGCCTTTGGAGGGAGCCTCAGG - Intergenic
1022264372 7:28739695-28739717 GAGAATTTGGAGGGAGGCTCAGG + Intronic
1024000993 7:45189314-45189336 GGGACAGTGGAGGGGAGCTGGGG + Intergenic
1028606266 7:92659703-92659725 GGGAGTTTGGAGGGGAGTACAGG + Intronic
1029049144 7:97665546-97665568 GGTACTGTGGAGGGAAGACCTGG - Intergenic
1029237426 7:99132567-99132589 GGGACTATGAAGGGATGGTCAGG + Intronic
1033220333 7:139523416-139523438 GGGACAGTGCAGGGAGGCTCAGG - Intergenic
1035564973 8:635372-635394 GGGACTTTGGAGGGAAGCTCAGG - Intronic
1035983668 8:4401846-4401868 GGGAATTTGGGGGGAAAGTCAGG - Intronic
1037102529 8:15064974-15064996 GAGACTTGGGATGGAGGCTCTGG - Intronic
1037910314 8:22740189-22740211 GGGACTCTGGAAGAAAGGTCAGG + Intronic
1039026120 8:33260247-33260269 GAGACTTTTCAGAGAAGCTCTGG - Intergenic
1039280337 8:35977504-35977526 TGGAGTTTAGAGGAAAGCTCTGG + Intergenic
1042376871 8:68061769-68061791 GAGAGTTTGGGGTGAAGCTCAGG + Intronic
1049618088 8:143585018-143585040 TGGACTTTGGAGGGACACTGTGG + Intronic
1049961556 9:742445-742467 GGGACTCTGGACGGGAGCTCTGG + Intronic
1054761977 9:69012384-69012406 CTGACTTTGGAAGGAGGCTCTGG - Intergenic
1056493225 9:87128802-87128824 GGGACAGTTGAGGGAAGATCAGG - Intergenic
1057547293 9:96027709-96027731 GGGGCCTTGGAGGGAAGCTAGGG - Intergenic
1057644841 9:96863849-96863871 GGGACTTGGGGAGGAAGGTCGGG + Intronic
1059457934 9:114411589-114411611 ATGACTTTCCAGGGAAGCTCAGG + Intronic
1060031085 9:120215637-120215659 GGGACTTGGCAGGGAAGTTTGGG + Intergenic
1061743286 9:132722710-132722732 GGGAGGTTGGAGGGGAGCTGAGG - Intergenic
1062040290 9:134401428-134401450 AGTACCTTGGAGGGGAGCTCTGG + Intronic
1062339573 9:136087938-136087960 GGGACTCTGCTGGGAAGTTCCGG + Intronic
1062339583 9:136087972-136087994 GGGACTCTGCTGGGAAGTTCCGG + Intronic
1186840004 X:13476012-13476034 GGGAGATTGTAGGGAAGCTTGGG + Intergenic
1187264066 X:17715164-17715186 GGGACTTTGGGAGCAAGGTCAGG - Intronic
1187831802 X:23389598-23389620 GGGCCTTTGGAGGCAAAGTCAGG + Intronic
1187836120 X:23434258-23434280 GGGACTTTGCATTGAAACTCAGG + Intergenic
1189206074 X:39240057-39240079 GGGACTTTAGAGTGGAACTCTGG - Intergenic
1190116443 X:47628768-47628790 GGGATTTTTGAGGGCAGCTCTGG - Intronic
1192235706 X:69294246-69294268 GGGCTTCTGGAGGGAAGCCCTGG + Intergenic
1195824132 X:108978870-108978892 GGGACTTTGTGGGGAAGGTTGGG - Intergenic
1195928168 X:110047101-110047123 GGGGATTTGGAGGGTAGCTCTGG + Intronic
1198977267 X:142350756-142350778 GGGAGTCTGGAGGGAAGGACAGG - Intergenic
1199671266 X:150150407-150150429 GGGACTGTGGAGGCCAGCACTGG - Intergenic
1200058313 X:153472870-153472892 GGGATGTTGGGGGGAAGCTGTGG + Intronic
1201916911 Y:19191702-19191724 GGGACTTTGTATTCAAGCTCTGG + Intergenic
1201942622 Y:19476306-19476328 GAGATTTTGGAGGCAAGCTATGG + Intergenic