ID: 1035564976

View in Genome Browser
Species Human (GRCh38)
Location 8:635381-635403
Sequence AGCCCTGCGGGGACTTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 142}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035564976_1035564986 22 Left 1035564976 8:635381-635403 CCCTCCAAAGTCCCCGCAGGGCT 0: 1
1: 0
2: 0
3: 17
4: 142
Right 1035564986 8:635426-635448 AGCTAAGGCTGGCTGTGAGAGGG No data
1035564976_1035564984 11 Left 1035564976 8:635381-635403 CCCTCCAAAGTCCCCGCAGGGCT 0: 1
1: 0
2: 0
3: 17
4: 142
Right 1035564984 8:635415-635437 ACAATAGTGACAGCTAAGGCTGG No data
1035564976_1035564985 21 Left 1035564976 8:635381-635403 CCCTCCAAAGTCCCCGCAGGGCT 0: 1
1: 0
2: 0
3: 17
4: 142
Right 1035564985 8:635425-635447 CAGCTAAGGCTGGCTGTGAGAGG No data
1035564976_1035564983 7 Left 1035564976 8:635381-635403 CCCTCCAAAGTCCCCGCAGGGCT 0: 1
1: 0
2: 0
3: 17
4: 142
Right 1035564983 8:635411-635433 ACTAACAATAGTGACAGCTAAGG No data
1035564976_1035564987 23 Left 1035564976 8:635381-635403 CCCTCCAAAGTCCCCGCAGGGCT 0: 1
1: 0
2: 0
3: 17
4: 142
Right 1035564987 8:635427-635449 GCTAAGGCTGGCTGTGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035564976 Original CRISPR AGCCCTGCGGGGACTTTGGA GGG (reversed) Intronic
900400946 1:2472650-2472672 AGCCCTGTGGGGGCTTCAGAGGG + Intronic
900401994 1:2476423-2476445 AGCCCTGTGGGGGCTTCGGAGGG + Exonic
900636363 1:3667926-3667948 AGCCCTGGGGGGACACTGAAGGG - Intronic
902287157 1:15414047-15414069 AGCCTAGCGGGGGCTCTGGAGGG + Intronic
902602869 1:17551917-17551939 AGCCACACGGGGACTGTGGACGG - Intronic
904769557 1:32873062-32873084 AGCCCTGGGTGAACTTGGGAGGG + Intergenic
905812929 1:40926204-40926226 AGGCCTGCTGGGAGTTTGAATGG + Intergenic
909384002 1:75035318-75035340 AGCCCTAAGGGGACATTGGTGGG + Intergenic
909889844 1:80991210-80991232 AGCTCTACAGGGACCTTGGAAGG + Intergenic
910251285 1:85201236-85201258 AGCCCTCCGGGGAGTGCGGAGGG + Intergenic
913229196 1:116727738-116727760 AGCCCTGTAGGGAATTTAGAGGG - Intergenic
915493526 1:156265462-156265484 AGCCCTGGAGGGACTTGGGATGG + Intronic
915937810 1:160099038-160099060 AGCCCTGCGGGGACGGGGAAGGG - Intergenic
917502336 1:175597257-175597279 AGCCCTGTGGGGACTTGGTCTGG - Intronic
917957643 1:180116942-180116964 AGCTTTGCTGGGACTTTGTAGGG - Intergenic
918077539 1:181181966-181181988 TGGCCTGCGGGCACTTGGGAGGG - Intergenic
1067037019 10:42928188-42928210 AGCCCGCCGGGGACTCAGGAGGG + Intergenic
1067058160 10:43064407-43064429 AGCCCTGCGGGGATTTTGCTGGG + Intergenic
1067099241 10:43322756-43322778 AGGGCTGCGGGGGCTTTGGAGGG + Intergenic
1068766471 10:60769757-60769779 ATCCCTGCGGTGGGTTTGGAAGG - Intergenic
1068865105 10:61886755-61886777 AGCCCTGAGGGAACTCGGGATGG - Intergenic
1070597235 10:77841164-77841186 AGCCCTGCGGGGGCTTGGATGGG - Intronic
1073180854 10:101582252-101582274 AGCCTTGCGTGGGCTTTAGAAGG + Intronic
1074916409 10:117960171-117960193 AGCCCTGCAGTGATTTTAGAGGG - Intergenic
1077311242 11:1889928-1889950 GGCCCTGGGGGGACTTGGGGTGG + Exonic
1078301431 11:10134919-10134941 AGCCCAGTGGGGACTCTGTATGG + Intronic
1079239462 11:18712361-18712383 GGCCCTGTGGAGGCTTTGGACGG + Exonic
1080346165 11:31328165-31328187 AGCCCTGAAGGCACTTTGGATGG - Exonic
1081612552 11:44571265-44571287 AGCCCAGCTGGGACTCAGGAAGG - Intronic
1082004264 11:47410980-47411002 AGCCCTGCGGGGTCAGTGCAGGG + Intronic
1084236357 11:67790293-67790315 AGCCCTGCGGTTACTGTGGCTGG + Intergenic
1084441131 11:69174035-69174057 AGACCTGTGGGGACATAGGATGG + Intergenic
1084749982 11:71198343-71198365 CCCCCTGTGGGGAGTTTGGAGGG + Intronic
1084836055 11:71802699-71802721 AGCCCTGCGGTTACTGTGGCTGG - Intergenic
1088412098 11:109545425-109545447 AGCCTTGCTGGGATTTTGGTAGG - Intergenic
1090374178 11:126277363-126277385 AGCCCTGAGGGGAGTGAGGATGG + Intronic
1091254525 11:134172214-134172236 AGTCCTGCGGGGATTTGGAATGG - Intronic
1094812254 12:34149894-34149916 AGCCCAGCAGGGCCTTTGGATGG - Intergenic
1096232594 12:49904553-49904575 AGCCCTGCTGGGACATTTCACGG + Intergenic
1099396347 12:82145753-82145775 AAACTTGCTGGGACTTTGGAAGG + Intergenic
1102956534 12:117062775-117062797 AGCCCGGCGGGGACCTAGGGAGG - Intronic
1108624960 13:52218711-52218733 AGCCCTGGGGGAACTCTGAAGGG - Intergenic
1108661092 13:52587706-52587728 AGCCCTGGGGGAACTCTGAAGGG + Intergenic
1108758176 13:53529588-53529610 AGGCCTGTGGGGAGTTTGGATGG + Intergenic
1113554482 13:111220702-111220724 CGCCCTGCCGGTCCTTTGGAGGG - Intronic
1117451375 14:55853309-55853331 AACCTTGCGGGGAGTGTGGATGG - Intergenic
1121743134 14:96267887-96267909 AGCCCCGGGGGGACCCTGGAAGG - Intronic
1122146261 14:99690712-99690734 AGCCATGTGGGGAGGTTGGAGGG + Intronic
1122530954 14:102426600-102426622 AGCACTTTGGGCACTTTGGAAGG + Intronic
1122770717 14:104096467-104096489 GGCCCTGGGGAGACTCTGGAGGG - Intronic
1123664803 15:22599694-22599716 ATCCCAGCTGGGACTTTGGACGG + Intergenic
1124318631 15:28694129-28694151 ATCCCAGCTGGGACTTTGGACGG + Intergenic
1124564813 15:30803315-30803337 ATCCCAGCTGGGACTTTGGACGG - Intergenic
1125242230 15:37588490-37588512 AGTCCTGCAGGGTGTTTGGATGG - Intergenic
1125536188 15:40441986-40442008 GGCCCTGCGGGGACCTTGCGGGG + Intronic
1129036779 15:72655025-72655047 CACCCTGCGGTGACTTTGGGCGG + Intronic
1129169283 15:73798023-73798045 GGCCCTGGGGGAACTTAGGAAGG + Intergenic
1129213108 15:74082200-74082222 CACCCTGCGGTGACTTTGGGCGG - Intronic
1129397292 15:75258886-75258908 CACCCTGCGGTGACTTTGGGCGG + Intronic
1129400903 15:75283163-75283185 CACCCTGCGGTGACTTTGGGCGG + Intronic
1129730244 15:77926516-77926538 CACCCTGCGGTGACTTTGGGCGG - Intergenic
1129823632 15:78620542-78620564 AGCCCGGCGGCGACTTGGGTGGG - Intronic
1132236071 15:100222612-100222634 AGCCCTCCAGGGATGTTGGATGG - Intronic
1132655014 16:1038166-1038188 AGGCCTGTGGGGACCTGGGAAGG - Intergenic
1132673066 16:1109680-1109702 AGCCCCGGGGGGACCTCGGATGG - Intergenic
1133061508 16:3177803-3177825 AGCCCTGCAGGGAAACTGGAGGG + Intergenic
1133347935 16:5082810-5082832 AGCCCTGCGGTTACTGTGGCTGG + Intronic
1145846310 17:28041914-28041936 AGCCCTGCGGGGCCGTTGCGCGG + Intronic
1145913572 17:28556836-28556858 ACCCCAGCGGGGACTATGGAAGG + Exonic
1146309631 17:31757271-31757293 AGCCCTTAGGGGACTCGGGAGGG + Intergenic
1146525846 17:33566339-33566361 GGCCCAGCAGGGACTGTGGAAGG - Intronic
1146628896 17:34455889-34455911 AGCCCAGCCGGGTCTTAGGAAGG + Intergenic
1148233773 17:45953675-45953697 AGCCCTGCAGGGATGGTGGAGGG + Intronic
1156388989 18:36633067-36633089 TGCCCTGCTGGCACTTGGGAGGG + Intronic
1156857523 18:41799498-41799520 AGCCCTGCAGGGCATGTGGAGGG + Intergenic
1157973003 18:52292686-52292708 TGCCCTGCCAGCACTTTGGAGGG + Intergenic
1160726615 19:620484-620506 GGCCCTGCGGGGACAGCGGATGG + Exonic
1164725804 19:30464895-30464917 GGCTCTTCGGGGAATTTGGATGG + Intronic
1165461001 19:35944465-35944487 AGCCCCGCAGGGAGTTTGGTGGG + Intronic
1167477701 19:49710499-49710521 GACCCTGCGGGGGCTGTGGATGG - Intronic
1167696039 19:51016053-51016075 AGCCCTGGTGGTACTTGGGATGG + Exonic
1168064756 19:53912793-53912815 CGCCCTGCGGGGCCTGTGGAAGG - Exonic
930059227 2:47274607-47274629 AGGCCAGCGGGGACATTGCAGGG + Intergenic
932489903 2:72114054-72114076 AGACCTGAGGGGACTTAGGTGGG - Intergenic
932732689 2:74232174-74232196 AGCCTTGTGGGGACCTTGGGTGG + Intronic
936526061 2:113242273-113242295 AGCCCTGGGGTGACTCTGGGGGG + Intronic
937100239 2:119263047-119263069 AGCCCAGTGAGGACTGTGGAGGG - Exonic
937296281 2:120811666-120811688 TGCCCTGAGAGGAATTTGGATGG + Intronic
937801177 2:126081919-126081941 AGACCTCTGGGGGCTTTGGATGG - Intergenic
940085785 2:149856973-149856995 ATCCCTTAGGGGACTTAGGAAGG - Intergenic
948364254 2:237444482-237444504 AGCCCCGAGGGGCCTGTGGAAGG - Intergenic
1172630468 20:36374940-36374962 AACCCTGCTGGGAGTTTGAATGG + Intronic
1178432105 21:32525961-32525983 ACCCCTGGGGGGAGTTTGGGGGG - Intergenic
1181362219 22:22346579-22346601 AGTCCTGCGGAGTCTCTGGAGGG - Intergenic
1181729023 22:24831306-24831328 AGCCCTGCGGGGAGTTCCAAGGG + Intronic
1182751957 22:32648906-32648928 CTCCCTGCAGGGAGTTTGGATGG + Intronic
1185009003 22:48302743-48302765 AGCCCTGAGGAGACTCTGGTTGG - Intergenic
1185035367 22:48473420-48473442 AGCCCTCCTGGCACTGTGGATGG - Intergenic
1185339463 22:50285029-50285051 AGCACTCGGGGGCCTTTGGATGG - Intronic
950330485 3:12152395-12152417 AGCCCTGAGGGTCCTTTGGTTGG + Intronic
950395106 3:12728122-12728144 AGCCCTGTGGGGGCTGTGGAGGG - Intergenic
955002735 3:54942236-54942258 AGCCATGCTGGGACTTTCAAGGG - Intronic
955862955 3:63352043-63352065 AGCCCTGTGAAGACCTTGGAGGG + Intronic
961302546 3:125931479-125931501 AGCCCTGCGGTTACTGTGGCTGG - Intronic
961885925 3:130096301-130096323 AGCCCTGCGGTTACTGTGGCTGG + Intronic
966594303 3:181712292-181712314 GGCCCGGCCGGGACTTTGGGGGG - Exonic
967814687 3:193788773-193788795 GGCCCTGGGGGGACTCTGGCAGG + Intergenic
968761242 4:2443607-2443629 AGTCCTGTGGGGACTCTGCAGGG + Intronic
968910348 4:3474125-3474147 AGCCCTGCAGGGGCTTCGAATGG + Intronic
969257582 4:6012940-6012962 TGCCCAGCGTGGACTTGGGAAGG - Intergenic
975944256 4:79685531-79685553 AGAGCTGCTGGGAGTTTGGAGGG + Intergenic
979193373 4:117890790-117890812 AGGCCTGCAGAGACTCTGGAGGG - Intergenic
980252510 4:130335908-130335930 TGGCCTGCCAGGACTTTGGAGGG - Intergenic
984667953 4:182448692-182448714 CGCCCCGCGGGGTCTTCGGAGGG + Intronic
986691101 5:10314616-10314638 AGCCTTTGGGGAACTTTGGAAGG + Intergenic
1005137263 6:22583957-22583979 ACCTCTGCAGGGCCTTTGGAAGG + Intergenic
1006867652 6:37222310-37222332 AGCCCTGGGGGGGCCATGGATGG - Intronic
1007967524 6:46015976-46015998 TGCCCTGCGGGGTCTTGGGGCGG - Intronic
1011342592 6:86333831-86333853 AATCCTGCTGGGACTTTGGTTGG - Intergenic
1011621302 6:89245358-89245380 ATACCTGCGTGGACTCTGGAAGG + Intergenic
1016706597 6:147115908-147115930 AACCCTACTGGGGCTTTGGAGGG + Intergenic
1018987706 6:168650095-168650117 AGCCCAGCGCGGACTGTGTATGG - Intronic
1019727770 7:2612482-2612504 GGCCCTGCGGGGACTTAGGCAGG + Exonic
1020319374 7:6928771-6928793 AGCCCTGCGGTTACTGTGGCTGG + Intergenic
1023477815 7:40599906-40599928 CACCCTACGGGCACTTTGGAAGG - Intronic
1024246516 7:47475224-47475246 AGCCCTGCAGTCACCTTGGAGGG + Intronic
1024765187 7:52649552-52649574 AGTCCTGAGGGGAAATTGGAAGG - Intergenic
1034277363 7:149829710-149829732 ATGACTGCGGGGACTGTGGAGGG - Intergenic
1034425202 7:151010364-151010386 AGTCCAGGGGGGACTTTGCATGG - Intronic
1034706777 7:153152654-153152676 AGCCCTGGGGAGAATCTGGATGG + Intergenic
1035259408 7:157652217-157652239 AGCCCGGCGGGGCCTTTGCTTGG - Intronic
1035564976 8:635381-635403 AGCCCTGCGGGGACTTTGGAGGG - Intronic
1036704801 8:11039080-11039102 AGACCTCAGGGGACTTTGGCAGG + Intronic
1036847631 8:12180617-12180639 AGCCCTGCGGTTACTGTGGCTGG + Intergenic
1036868999 8:12422932-12422954 AGCCCTGCGGTTACTGTGGCTGG + Intergenic
1040317647 8:46273371-46273393 AGCCCTGCGGGCTCCTGGGATGG - Intergenic
1040690922 8:49937349-49937371 AGGCCTGCGGGGACTTTTAGGGG + Intronic
1044900982 8:96944306-96944328 TGCCTGGAGGGGACTTTGGAGGG - Intronic
1047004032 8:120601110-120601132 AGCGCTGCTGGGAATCTGGATGG + Intronic
1048963858 8:139601064-139601086 GGCCCGGCGGGGACTGGGGAGGG - Intronic
1049244623 8:141555612-141555634 AGCCCTGGGGGGCCCTGGGAAGG + Intergenic
1049839633 8:144762804-144762826 AGTCCAGCGGGGACTGTGGGGGG - Intergenic
1049839645 8:144762842-144762864 AGTCCAGCGGGGACTGTGGGGGG - Intergenic
1049839666 8:144762914-144762936 AGTCCAGCGGGGACTGTGGGGGG - Intergenic
1049839677 8:144762952-144762974 AGTCCAGCGGGGACTGTGGGGGG - Intergenic
1050111322 9:2219588-2219610 GAGCCTGCGGGGACTTTGGTGGG + Intergenic
1052126077 9:24775938-24775960 ACCTCTGTGGGGACTTTGGCAGG - Intergenic
1056926048 9:90835298-90835320 AGCCCAGCGGAGATGTTGGATGG + Intronic
1056965533 9:91160772-91160794 AGCCCTGGGGGCAGTTTGGGTGG - Intergenic
1059464413 9:114458649-114458671 AGCACTGCAGGCACTTTGGTGGG + Intronic
1059976049 9:119718290-119718312 AGCACTGGGGAGACTTTGGAGGG + Intergenic
1060140509 9:121205496-121205518 AGCACTGGAGGGGCTTTGGATGG + Intronic
1060208153 9:121694642-121694664 AGGCCTGGGGGGTCTTTGGCTGG - Intronic
1060460108 9:123844673-123844695 AGCCCAGCTGGGATTTTGGTAGG - Intronic
1061041729 9:128144644-128144666 TGCCCTGCGGGGGCTGAGGATGG - Intergenic
1061391943 9:130321587-130321609 AGCCCTGCAGGGTCTCTGGAGGG + Intronic
1062696797 9:137879807-137879829 AGCCCTGTGGGGTCTCTGGAGGG + Intronic
1191207240 X:57848014-57848036 AGACCTGCGTGTCCTTTGGAGGG + Intergenic
1198297491 X:135301813-135301835 ACCCCAGCGGGGACTCTGTATGG + Intronic
1202129549 Y:21597503-21597525 AGGCCTGGGTGGACTTTGTAGGG - Intergenic