ID: 1035564977

View in Genome Browser
Species Human (GRCh38)
Location 8:635382-635404
Sequence GAGCCCTGCGGGGACTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 191}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035564977_1035564984 10 Left 1035564977 8:635382-635404 CCTCCAAAGTCCCCGCAGGGCTC 0: 1
1: 0
2: 0
3: 23
4: 191
Right 1035564984 8:635415-635437 ACAATAGTGACAGCTAAGGCTGG No data
1035564977_1035564987 22 Left 1035564977 8:635382-635404 CCTCCAAAGTCCCCGCAGGGCTC 0: 1
1: 0
2: 0
3: 23
4: 191
Right 1035564987 8:635427-635449 GCTAAGGCTGGCTGTGAGAGGGG No data
1035564977_1035564985 20 Left 1035564977 8:635382-635404 CCTCCAAAGTCCCCGCAGGGCTC 0: 1
1: 0
2: 0
3: 23
4: 191
Right 1035564985 8:635425-635447 CAGCTAAGGCTGGCTGTGAGAGG No data
1035564977_1035564983 6 Left 1035564977 8:635382-635404 CCTCCAAAGTCCCCGCAGGGCTC 0: 1
1: 0
2: 0
3: 23
4: 191
Right 1035564983 8:635411-635433 ACTAACAATAGTGACAGCTAAGG No data
1035564977_1035564986 21 Left 1035564977 8:635382-635404 CCTCCAAAGTCCCCGCAGGGCTC 0: 1
1: 0
2: 0
3: 23
4: 191
Right 1035564986 8:635426-635448 AGCTAAGGCTGGCTGTGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035564977 Original CRISPR GAGCCCTGCGGGGACTTTGG AGG (reversed) Intronic
900401993 1:2476422-2476444 CAGCCCTGTGGGGGCTTCGGAGG + Exonic
900568044 1:3344801-3344823 CAGCCCTTCTGGGACTTTAGTGG + Intronic
900589021 1:3451329-3451351 GACCCCTGTGGGGATTTTGGGGG + Intergenic
900636364 1:3667927-3667949 GAGCCCTGGGGGGACACTGAAGG - Intronic
900641762 1:3690969-3690991 GATCTCTTCGGGGACTTTGCGGG + Intronic
900718445 1:4159909-4159931 GAGCCCTGCCGGGACTCAGCAGG + Intergenic
904769556 1:32873061-32873083 GAGCCCTGGGTGAACTTGGGAGG + Intergenic
906175165 1:43764898-43764920 GAGCCCTTTGGGCACTATGGTGG - Intronic
909384001 1:75035317-75035339 GAGCCCTAAGGGGACATTGGTGG + Intergenic
910251284 1:85201235-85201257 GAGCCCTCCGGGGAGTGCGGAGG + Intergenic
913936304 1:125053770-125053792 GAGCGCTTTGGGGACTATGGTGG + Intergenic
916235056 1:162578490-162578512 GATGCCTGTGGGGAATTTGGAGG + Intronic
917957644 1:180116943-180116965 GAGCTTTGCTGGGACTTTGTAGG - Intergenic
918077540 1:181181967-181181989 GTGGCCTGCGGGCACTTGGGAGG - Intergenic
920006157 1:202835392-202835414 GGGCCCTGCTGGCAATTTGGTGG - Intergenic
921371522 1:214427983-214428005 GTGCCCTGCGAGGCCTTTTGTGG - Intronic
924954549 1:248914171-248914193 AAACCCTGCGGGGACTGAGGTGG - Intronic
1065934920 10:30512781-30512803 GAGCCCTGAGGAGACTTTTAAGG - Intergenic
1066817038 10:39432018-39432040 GAGCCCTTTGAGGACTATGGTGG - Intergenic
1066820490 10:39480726-39480748 GAGCCCTTCGTGGCCTATGGTGG - Intergenic
1066821331 10:39494284-39494306 GAGCCCTTTGTGGACTATGGTGG + Intergenic
1067058159 10:43064406-43064428 TAGCCCTGCGGGGATTTTGCTGG + Intergenic
1067099240 10:43322755-43322777 GAGGGCTGCGGGGGCTTTGGAGG + Intergenic
1070158776 10:73852995-73853017 GAGCCCTGGGGGGACGCTGGGGG + Intronic
1070597236 10:77841165-77841187 GAGCCCTGCGGGGGCTTGGATGG - Intronic
1075086198 10:119415897-119415919 GAGCCCTGAGGGGTCTTTCCTGG + Intronic
1075697571 10:124447955-124447977 GAGCCCTGCGAGGACGGCGGGGG - Exonic
1076198676 10:128540516-128540538 GCGCCCTGCCGTAACTTTGGGGG + Intergenic
1076243834 10:128931010-128931032 GAGCCCTGCAGGGACACAGGAGG - Intergenic
1076340497 10:129742003-129742025 GGGCTCTGGGGAGACTTTGGGGG + Intronic
1076849549 10:133086318-133086340 GAGTCCCACGGGGACTTTGCGGG - Intronic
1077142644 11:1031201-1031223 GGGCTCTGCGGGAACTTTGACGG - Exonic
1077310698 11:1887849-1887871 GAGCCCTGCTGTGGCTTTTGGGG - Intronic
1078716114 11:13840383-13840405 GGGCCCTTCAGGGACTTTAGGGG - Intergenic
1079284658 11:19117551-19117573 GAGCCCGGCGGGGACCTCTGTGG + Intronic
1082554485 11:54545353-54545375 GAGCACTGCGAGGCCTGTGGTGG + Intergenic
1084072040 11:66743129-66743151 GAGCTCTGCGGGGGGTGTGGGGG + Intergenic
1088950747 11:114567347-114567369 GAACCCTGCCTGGACTATGGAGG + Intergenic
1088975526 11:114813002-114813024 GTGCCCTGCTGGGGCTCTGGGGG + Intergenic
1091842446 12:3630733-3630755 GAGCCCTGCGGGCATCCTGGAGG - Intronic
1095033809 12:37330376-37330398 GAGCCCTTTGAGGACTATGGTGG + Intergenic
1095058938 12:37658810-37658832 GAGCGCTCTGGGGACTATGGTGG + Intergenic
1096974113 12:55688783-55688805 GAGTCCTGGAGGGGCTTTGGAGG + Intronic
1101804454 12:108051299-108051321 GAGCCCTGGGGTGGCTATGGGGG + Intergenic
1101804732 12:108053437-108053459 GAGCTCTGGGGTGGCTTTGGGGG + Intergenic
1103936821 12:124481440-124481462 TAGCCCTGTGGGGACTCTCGAGG - Intronic
1105072239 12:133241681-133241703 GAGCCCTGCCTGGGCTTGGGCGG + Intergenic
1105075102 13:16006241-16006263 GAGCCCTTTGGGGCCTATGGTGG + Intergenic
1110331195 13:74275092-74275114 GAGCCATGTGAGGATTTTGGGGG + Intergenic
1113999371 14:16137402-16137424 GAGCCCTTTGGGGCCTATGGTGG - Intergenic
1115361642 14:32509802-32509824 GAGTCCTGCTGGGACTCTGCTGG + Intronic
1117450253 14:55843114-55843136 CAGCCCTGCGGGGACCAAGGTGG + Intergenic
1120349395 14:83333707-83333729 GATCTCTGTGGAGACTTTGGGGG - Intergenic
1121953916 14:98197109-98197131 GACCCTTGCTGGTACTTTGGTGG - Intergenic
1122058582 14:99121720-99121742 GAGCCCTGCGGATACCTGGGGGG - Intergenic
1122358018 14:101135906-101135928 GATCCAGGTGGGGACTTTGGGGG + Intergenic
1122770718 14:104096468-104096490 GGGCCCTGGGGAGACTCTGGAGG - Intronic
1123067750 14:105626942-105626964 GAGCCCAGCAGGGACCTTGCCGG - Intergenic
1123071769 14:105645667-105645689 GAGCCCAGCAGGGACCTTGCCGG - Intergenic
1123091433 14:105743943-105743965 GAGCCCAGCAGGGACCTTGCCGG - Intergenic
1123097203 14:105772284-105772306 GAGCCCAGCAGGGACCTTGCCGG - Intergenic
1124639859 15:31391064-31391086 GAGGGCTGTGGGGACTATGGCGG + Intronic
1125536187 15:40441985-40442007 AGGCCCTGCGGGGACCTTGCGGG + Intronic
1129612415 15:77071129-77071151 GAGCCCTGAGGGGACTGCGGCGG - Exonic
1129823633 15:78620543-78620565 CAGCCCGGCGGCGACTTGGGTGG - Intronic
1131821789 15:96281431-96281453 GATCCCTGCAGGGAATTTTGTGG - Intergenic
1132933323 16:2469496-2469518 GAACCCTGGGGGGACTATGGGGG - Intergenic
1137079670 16:36030922-36030944 GAGCCCTTTGGGGCCTATGGTGG + Intergenic
1139655933 16:68387294-68387316 GAACCCAGCGGGGTCTTTGGAGG + Intronic
1141957864 16:87384341-87384363 GAGCTCTGCAGGGACCTTCGGGG + Intronic
1143658496 17:8311142-8311164 GACCCCTGAAGGGAGTTTGGGGG + Intronic
1147755044 17:42762060-42762082 GAGCCGTGCAGGGGCTTTGTAGG - Intronic
1149665500 17:58362519-58362541 GAGCAGTGTGGGGTCTTTGGCGG - Intronic
1150215839 17:63468649-63468671 GAGCCCAGCGGGGACTGGGCTGG + Intergenic
1152546698 17:81003971-81003993 GCGCTCTGCGGGGGCTCTGGCGG + Intronic
1152749434 17:82055831-82055853 GAGCCCTCTGGGGACTTGGGAGG + Intronic
1156388988 18:36633066-36633088 GTGCCCTGCTGGCACTTGGGAGG + Intronic
1157973002 18:52292685-52292707 GTGCCCTGCCAGCACTTTGGAGG + Intergenic
1160793926 19:935154-935176 GAGCCCTGCCAGGACCTGGGAGG - Intronic
1161221403 19:3119808-3119830 CAGCCCCGTGGGGACCTTGGTGG + Intronic
1163782698 19:19258636-19258658 GAGCCCTGCGGCGGCCTGGGGGG - Exonic
1164342219 19:24415159-24415181 GAGCCCTTCGAGGCCTATGGTGG + Intergenic
1165087887 19:33364018-33364040 AAGCCCTCAGGAGACTTTGGGGG - Intergenic
1165461000 19:35944464-35944486 TAGCCCCGCAGGGAGTTTGGTGG + Intronic
1166738840 19:45102130-45102152 GAGACCTGAAGGGACTGTGGAGG - Intronic
1167078256 19:47262135-47262157 GAGCCCTGCAGGGAGGTGGGTGG + Intronic
1167508165 19:49882033-49882055 GAGTCCTGCGGGGAGCTGGGAGG - Exonic
1167617376 19:50542934-50542956 GAACCTCGCGGGGACTTTGGGGG - Intronic
1167971945 19:53193208-53193230 GAGCCGTGCGGGGACTTTAAGGG + Intronic
926122802 2:10254056-10254078 GAGCCCTGAGGCGAGTGTGGTGG + Intergenic
926127104 2:10278329-10278351 GAGGCCATCGGGGGCTTTGGGGG + Intergenic
926651766 2:15354291-15354313 GATCCCTGCTGGGAGTTGGGGGG - Intronic
929118668 2:38465872-38465894 GAGCCACGCTGGGACCTTGGTGG - Intergenic
932489904 2:72114055-72114077 CAGACCTGAGGGGACTTAGGTGG - Intergenic
934472707 2:94569106-94569128 GAGCCCTTTTGGGCCTTTGGTGG - Intergenic
934758815 2:96842279-96842301 GAGGCCTGGAGGGACTCTGGTGG - Intronic
936526060 2:113242272-113242294 CAGCCCTGGGGTGACTCTGGGGG + Intronic
937127221 2:119482360-119482382 GACGCCTGTGGGGGCTTTGGAGG + Intronic
938533095 2:132210846-132210868 GAGCCCTTTGGGGCCTATGGTGG + Intronic
943669974 2:190649460-190649482 GGGCCACGCGGGCACTTTGGGGG + Intronic
946158490 2:217822058-217822080 GAGCCCTGCCTGTCCTTTGGGGG - Intronic
946410339 2:219512380-219512402 GAGTGCTGCGGAGAGTTTGGGGG + Intergenic
947944983 2:234093580-234093602 GAGCCGTGCAAGCACTTTGGAGG - Intergenic
948201233 2:236130916-236130938 GAGCCCTGCTGGGACCCTTGGGG - Exonic
948709993 2:239819509-239819531 GAGCACTGAGGGGACCTCGGGGG + Intergenic
1169557537 20:6767408-6767430 GACCCTCGCGGGGACTCTGGAGG - Intergenic
1171735122 20:28771273-28771295 GAGCCCTTTGGGGCCTATGGTGG - Intergenic
1171808490 20:29715428-29715450 GAGAGCTGTGAGGACTTTGGTGG - Intergenic
1171808567 20:29717132-29717154 GAGAGCTGTGAGGACTTTGGTGG - Intergenic
1171825191 20:29893269-29893291 GAGCCCTTTGGGGCCTATGGTGG + Intergenic
1171832240 20:30027473-30027495 GAGCGCTTTGAGGACTTTGGTGG + Intergenic
1171833316 20:30098237-30098259 GAGCGCTTTGAGGACTTTGGTGG + Intergenic
1171833810 20:30107783-30107805 GAGCGCTTTGAGGACTTTGGTGG + Intergenic
1171833853 20:30108640-30108662 GAGCGCTTTGAGGACTTTGGTGG + Intergenic
1171834063 20:30112735-30112757 GAGCGCTTTGAGGACTTTGGTGG + Intergenic
1171834285 20:30117186-30117208 GAGCGCTTTGAGGACTTTGGTGG + Intergenic
1171834439 20:30120222-30120244 GAGCGCTTTGAGGACTTTGGTGG + Intergenic
1171835041 20:30131383-30131405 GAGCGCTTTGAGGACTTTGGTGG + Intergenic
1172619481 20:36309566-36309588 CAGACCTGCTGGGACTTTAGGGG - Intronic
1173927738 20:46793200-46793222 GAGCCCTGCTGTGCCTATGGAGG - Intergenic
1175625814 20:60487402-60487424 GAGGGCTGGAGGGACTTTGGGGG + Intergenic
1175868614 20:62195880-62195902 GAGCCCCGCAAGGAGTTTGGAGG + Exonic
1176170750 20:63695389-63695411 GAGGCCAGCAGGGACTGTGGGGG + Exonic
1176535828 21:8049629-8049651 GAGCCCTTTGGGGCCTATGGTGG - Intergenic
1178432106 21:32525962-32525984 GACCCCTGGGGGGAGTTTGGGGG - Intergenic
1178599689 21:33984985-33985007 GGGCCCTGCGGGGAATGGGGTGG + Intergenic
1180324984 22:11362601-11362623 GAGCCCTTTGGGGCCTATGGTGG + Intergenic
1180400057 22:12408338-12408360 GAGCCCTTTGGGGCCTATGGTGG + Intergenic
1181362220 22:22346580-22346602 GAGTCCTGCGGAGTCTCTGGAGG - Intergenic
1182109538 22:27713193-27713215 GAGCCCTCGGGGGTCTTCGGGGG + Intergenic
1184353712 22:43963857-43963879 AATCCCTGCGGGGTCTTTAGAGG + Intronic
1185343011 22:50299930-50299952 GCGCCCTCCGGGGAGTCTGGCGG - Intronic
950395107 3:12728123-12728145 TAGCCCTGTGGGGGCTGTGGAGG - Intergenic
951217752 3:20040574-20040596 GAGCCCTGCGGGGGCGCGGGCGG - Exonic
951558741 3:23945643-23945665 GAGCCCGCGGGGCACTTTGGGGG + Intronic
952207161 3:31191648-31191670 GAGCCCTGACGTGGCTTTGGAGG - Intergenic
952885792 3:38010271-38010293 GTGCCCTGCGGGGAGGGTGGTGG + Exonic
954205727 3:49057517-49057539 GAGCCCTGCTGGGATGGTGGTGG + Exonic
954665661 3:52250246-52250268 GCCACCTGCGTGGACTTTGGGGG - Exonic
955375634 3:58394183-58394205 GAGCTATGCAGGGATTTTGGAGG - Intronic
955766945 3:62354855-62354877 AAGACCTGCTGGGACTCTGGAGG + Intergenic
956772142 3:72535670-72535692 GAGCCATGAGGGGTCTTGGGAGG - Intergenic
958405672 3:93755751-93755773 GAGCGCTTCGAGGACTATGGAGG - Intergenic
960466086 3:117997715-117997737 GAGAGCAGAGGGGACTTTGGCGG - Intergenic
961112062 3:124292630-124292652 GTGCCCTGCGGTCACTCTGGGGG + Intronic
966594304 3:181712293-181712315 CGGCCCGGCCGGGACTTTGGGGG - Exonic
967106509 3:186258943-186258965 GTGCCCTGCGGACACCTTGGGGG + Intronic
975944255 4:79685530-79685552 GAGAGCTGCTGGGAGTTTGGAGG + Intergenic
977867737 4:102049949-102049971 GAGCCCTGCCAGCACTTGGGAGG - Intronic
980252511 4:130335909-130335931 GTGGCCTGCCAGGACTTTGGAGG - Intergenic
982168715 4:152640250-152640272 GAGCTCTGCTGTGACCTTGGAGG - Intronic
982437899 4:155399161-155399183 GTGCCCTGCAGTGTCTTTGGAGG + Intergenic
985788922 5:1915126-1915148 GAGCAATGCGGGGACTCAGGGGG - Intergenic
986812689 5:11376916-11376938 GAGCTCTGTCTGGACTTTGGAGG - Intronic
987421088 5:17720649-17720671 TACCCCTGCGGGGACTGTGAAGG - Intergenic
990492169 5:56313163-56313185 GAGTGCTGCTGGCACTTTGGAGG - Intergenic
992662432 5:78974847-78974869 GAGCCCTGGGGTGACTTTCATGG - Intronic
995129739 5:108617832-108617854 GACCCCAGTGGGCACTTTGGAGG + Intergenic
1000165029 5:158640048-158640070 GGGCTCTGTGGGGACTATGGAGG - Intergenic
1001581180 5:172799612-172799634 GAGCCCAGCCTGGGCTTTGGAGG + Intergenic
1002566954 5:180117467-180117489 GTGCCATGCGGGAACATTGGTGG - Intronic
1006832701 6:36978204-36978226 GAACTCTTCGGGGACTTGGGCGG + Intronic
1008177582 6:48287923-48287945 GAGCCTTAAGGGGACATTGGTGG - Intergenic
1012996641 6:105981679-105981701 GCGGCCTGCGGGGCCTTTGGGGG + Intergenic
1022960235 7:35419170-35419192 GAGCCCTGCGGGGTCTGTGATGG - Intergenic
1024246515 7:47475223-47475245 GAGCCCTGCAGTCACCTTGGAGG + Intronic
1025314122 7:57996270-57996292 GAGCCCTTTGGGGCCTATGGTGG + Intergenic
1025315387 7:58018411-58018433 GAGCGCTTTGAGGACTTTGGTGG + Intergenic
1025919490 7:65897664-65897686 GAGACATGAGGGGATTTTGGAGG + Intronic
1029238687 7:99143656-99143678 GCGCCCTGCGGGGAATTCCGGGG + Intronic
1030201236 7:106907259-106907281 AAGCCCTGCGTGGCCTTTGAAGG + Intergenic
1030816832 7:114049213-114049235 GATCCAAGCGGGCACTTTGGAGG - Intronic
1032082386 7:128866164-128866186 GGGCCCTGCGGGAGTTTTGGGGG + Intronic
1032193738 7:129778566-129778588 GAGCCGCGCGGGGAATGTGGGGG + Intergenic
1033619518 7:143049625-143049647 GAGCCCTCTGGGGACTTCTGAGG - Intergenic
1034277364 7:149829711-149829733 GATGACTGCGGGGACTGTGGAGG - Intergenic
1035284558 7:157797871-157797893 GAGAGCTGCGGGGCCTCTGGAGG - Intronic
1035564977 8:635382-635404 GAGCCCTGCGGGGACTTTGGAGG - Intronic
1036574277 8:10011257-10011279 AAGCACTGAGGGGACATTGGCGG + Intergenic
1038312493 8:26455358-26455380 CAGGCCTGCGGGGAGTATGGGGG - Intronic
1040272799 8:45974678-45974700 GAGCCCTTTGAGGACTATGGTGG + Intergenic
1040690921 8:49937348-49937370 GAGGCCTGCGGGGACTTTTAGGG + Intronic
1045208788 8:100072627-100072649 GGGGCCTGCAGTGACTTTGGTGG - Intronic
1046662945 8:116968616-116968638 GAGACCTGCAGTGCCTTTGGTGG - Intronic
1047298157 8:123589247-123589269 GAGCCATGGGAGGACTGTGGAGG - Intergenic
1048963859 8:139601065-139601087 GGGCCCGGCGGGGACTGGGGAGG - Intronic
1049839634 8:144762805-144762827 GAGTCCAGCGGGGACTGTGGGGG - Intergenic
1049839646 8:144762843-144762865 GAGTCCAGCGGGGACTGTGGGGG - Intergenic
1049839656 8:144762877-144762899 GAGTCCAGCGGGGACTGTGGGGG - Intergenic
1049839667 8:144762915-144762937 GAGTCCAGCGGGGACTGTGGGGG - Intergenic
1049839678 8:144762953-144762975 GAGTCCAGCGGGGACTGTGGGGG - Intergenic
1050111321 9:2219587-2219609 TGAGCCTGCGGGGACTTTGGTGG + Intergenic
1051358924 9:16264915-16264937 GAGGCATGCGGGGTCTCTGGAGG - Intronic
1055934265 9:81590280-81590302 GAGCCCTGCGGGCTCCTGGGTGG + Intronic
1057219992 9:93252275-93252297 GAGCCATGCGAGGCCTCTGGGGG + Intronic
1059464412 9:114458648-114458670 GAGCACTGCAGGCACTTTGGTGG + Intronic
1059976048 9:119718289-119718311 CAGCACTGGGGAGACTTTGGAGG + Intergenic
1060229220 9:121814598-121814620 GAGCCCTGAGGGGATCCTGGGGG + Intergenic
1060796229 9:126514553-126514575 GGGCGCTGCGGGGACTTGCGCGG - Intergenic
1061391942 9:130321586-130321608 CAGCCCTGCAGGGTCTCTGGAGG + Intronic
1061760994 9:132851226-132851248 CAGTCCTGCGGTGACTGTGGTGG + Intronic
1062563957 9:137155693-137155715 GAGACCTGGTGGGACTCTGGAGG - Intronic
1062606116 9:137349604-137349626 CAGCCCTGCGGGGGCTCTGGAGG + Intronic
1062696796 9:137879806-137879828 CAGCCCTGTGGGGTCTCTGGAGG + Intronic
1203341563 Un_KI270424v1:322-344 GAGCACTGCGAGGCCTGTGGTGG + Intergenic
1203380804 Un_KI270435v1:37732-37754 GAGCCCTGTGCGGCCTGTGGTGG + Intergenic
1203372630 Un_KI270442v1:323173-323195 GAGCCCTTTGGGGCCTATGGTGG + Intergenic
1203372655 Un_KI270442v1:323513-323535 GAGCCCTTTGGGGCCTATGGTGG + Intergenic
1203414839 Un_KI270590v1:2354-2376 GAGCCCTTTGGGGCCTTTTGTGG - Intergenic
1187952631 X:24485794-24485816 GAGCCCTGTGGGGCTCTTGGCGG - Intronic
1191567045 X:62552818-62552840 GAGCCCTTTGCGGCCTTTGGTGG + Intergenic
1195037874 X:100986558-100986580 GAGCCCTGGGGGGACTATCTTGG + Intronic
1196716978 X:118821773-118821795 GACTCCTGTGGGAACTTTGGGGG - Intergenic
1197765610 X:130057705-130057727 GAGCCATGCGGGAGCATTGGTGG + Exonic
1201079973 Y:10232712-10232734 GAGCCCTGTGTGGCCTATGGTGG - Intergenic