ID: 1035564977

View in Genome Browser
Species Human (GRCh38)
Location 8:635382-635404
Sequence GAGCCCTGCGGGGACTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035564977_1035564987 22 Left 1035564977 8:635382-635404 CCTCCAAAGTCCCCGCAGGGCTC No data
Right 1035564987 8:635427-635449 GCTAAGGCTGGCTGTGAGAGGGG No data
1035564977_1035564985 20 Left 1035564977 8:635382-635404 CCTCCAAAGTCCCCGCAGGGCTC No data
Right 1035564985 8:635425-635447 CAGCTAAGGCTGGCTGTGAGAGG No data
1035564977_1035564984 10 Left 1035564977 8:635382-635404 CCTCCAAAGTCCCCGCAGGGCTC No data
Right 1035564984 8:635415-635437 ACAATAGTGACAGCTAAGGCTGG No data
1035564977_1035564986 21 Left 1035564977 8:635382-635404 CCTCCAAAGTCCCCGCAGGGCTC No data
Right 1035564986 8:635426-635448 AGCTAAGGCTGGCTGTGAGAGGG No data
1035564977_1035564983 6 Left 1035564977 8:635382-635404 CCTCCAAAGTCCCCGCAGGGCTC No data
Right 1035564983 8:635411-635433 ACTAACAATAGTGACAGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035564977 Original CRISPR GAGCCCTGCGGGGACTTTGG AGG (reversed) Intronic