ID: 1035564978

View in Genome Browser
Species Human (GRCh38)
Location 8:635385-635407
Sequence GATGAGCCCTGCGGGGACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 125}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035564978_1035564985 17 Left 1035564978 8:635385-635407 CCAAAGTCCCCGCAGGGCTCATC 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1035564985 8:635425-635447 CAGCTAAGGCTGGCTGTGAGAGG No data
1035564978_1035564983 3 Left 1035564978 8:635385-635407 CCAAAGTCCCCGCAGGGCTCATC 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1035564983 8:635411-635433 ACTAACAATAGTGACAGCTAAGG No data
1035564978_1035564987 19 Left 1035564978 8:635385-635407 CCAAAGTCCCCGCAGGGCTCATC 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1035564987 8:635427-635449 GCTAAGGCTGGCTGTGAGAGGGG No data
1035564978_1035564986 18 Left 1035564978 8:635385-635407 CCAAAGTCCCCGCAGGGCTCATC 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1035564986 8:635426-635448 AGCTAAGGCTGGCTGTGAGAGGG No data
1035564978_1035564984 7 Left 1035564978 8:635385-635407 CCAAAGTCCCCGCAGGGCTCATC 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1035564984 8:635415-635437 ACAATAGTGACAGCTAAGGCTGG No data
1035564978_1035564988 28 Left 1035564978 8:635385-635407 CCAAAGTCCCCGCAGGGCTCATC 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1035564988 8:635436-635458 GGCTGTGAGAGGGGCTGTCTAGG No data
1035564978_1035564989 29 Left 1035564978 8:635385-635407 CCAAAGTCCCCGCAGGGCTCATC 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1035564989 8:635437-635459 GCTGTGAGAGGGGCTGTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035564978 Original CRISPR GATGAGCCCTGCGGGGACTT TGG (reversed) Intronic
900982880 1:6056624-6056646 GTAGAGCCTTGCGGGGAGTTTGG - Intronic
902704686 1:18196403-18196425 GACGCGCCCTGCAGGGACTCAGG - Intronic
905669057 1:39779194-39779216 GCAGGGCCCTGTGGGGACTTGGG + Intronic
905852459 1:41284044-41284066 GATGAGCCTCTCGGGGACCTTGG + Intergenic
909384000 1:75035314-75035336 CATGAGCCCTAAGGGGACATTGG + Intergenic
913532369 1:119742218-119742240 GAGGAGCCCTGAGGGGAGTTAGG - Intronic
915462244 1:156077046-156077068 GGTGAGCAGGGCGGGGACTTTGG - Exonic
916361724 1:163977470-163977492 AATGAGCCCTGGGGGCACTTCGG - Intergenic
918523251 1:185438081-185438103 GATGAGCCCAGATGGGAATTAGG - Intergenic
922997151 1:229973226-229973248 GAGGGGCCCTGCGGGCAGTTTGG - Intergenic
923033245 1:230266278-230266300 GATGGGCCCAGCTGAGACTTCGG + Intronic
924954550 1:248914174-248914196 GAGAAACCCTGCGGGGACTGAGG - Intronic
1062971383 10:1651818-1651840 GAAGAGCCCTGAGGGGCCCTGGG - Intronic
1063595605 10:7432371-7432393 GATGAAGCCTTCGGGGATTTGGG - Intergenic
1065804670 10:29383454-29383476 GATGAGGCCTCCGGGGAGTGTGG + Intergenic
1067311690 10:45119823-45119845 AATGAGCCCTTCAGGCACTTTGG - Intergenic
1067778237 10:49178135-49178157 GATGAGCCCTGGGAGGACATTGG - Intronic
1070551474 10:77493980-77494002 GGTGAGCCCTGTGGGAATTTCGG + Intronic
1071972860 10:90925644-90925666 TATGAGCCCTGCTGGGTCTCAGG - Intergenic
1074806972 10:117063667-117063689 GATGAGGCCTGGGGGTAGTTGGG - Intronic
1076687482 10:132204605-132204627 CATGAAACCTGCGGGGACTGTGG - Intronic
1077093783 11:790915-790937 GGTGGGCCCTGAGAGGACTTGGG + Exonic
1077311240 11:1889924-1889946 GCTGGGCCCTGGGGGGACTTGGG + Exonic
1079165222 11:18034547-18034569 GAGGAGCCCTCAAGGGACTTGGG + Intronic
1084236356 11:67790289-67790311 GAGGAGCCCTGCGGTTACTGTGG + Intergenic
1084836056 11:71802703-71802725 GAGGAGCCCTGCGGTTACTGTGG - Intergenic
1089680774 11:120117744-120117766 GATCAGCCTTGGGGGGACTTAGG + Intronic
1090374177 11:126277359-126277381 GCTGAGCCCTGAGGGGAGTGAGG + Intronic
1091703795 12:2680408-2680430 GAGGAGCCCTGCGGGGGCCCAGG - Intronic
1101499832 12:105292809-105292831 GCTTAGCACTGTGGGGACTTAGG + Intronic
1119309314 14:73633363-73633385 AACGAGCCCAGCGGGGACATAGG - Intergenic
1119984265 14:79118067-79118089 GCTGACCCCTGCTGGGACTGTGG + Intronic
1122058585 14:99121723-99121745 GGTGAGCCCTGCGGATACCTGGG - Intergenic
1202890056 14_KI270722v1_random:148322-148344 GATGAGCCCTACAGGGTCTTTGG + Intergenic
1123699457 15:22903636-22903658 GAGGAAGCCTGCGGGGACATGGG + Intronic
1124165761 15:27324361-27324383 GATCTGCCCAGTGGGGACTTAGG - Intronic
1124318630 15:28694125-28694147 GGTGATCCCAGCTGGGACTTTGG + Intergenic
1124564814 15:30803319-30803341 GGTGATCCCAGCTGGGACTTTGG - Intergenic
1128447189 15:67774494-67774516 AGTGAGCCCTGCCTGGACTTTGG + Intronic
1131227662 15:90638720-90638742 GATGAGCCCTTCAGGGAATAAGG - Exonic
1132787839 16:1667947-1667969 GATGAGCCCTGCTGGGAGACAGG - Exonic
1132933326 16:2469499-2469521 GAGGAACCCTGGGGGGACTATGG - Intergenic
1133347934 16:5082806-5082828 GAGGAGCCCTGCGGTTACTGTGG + Intronic
1134890155 16:17834365-17834387 GATGAGCATTGCTGGGCCTTTGG + Intergenic
1137464008 16:48691537-48691559 TATGATCCCAGCAGGGACTTGGG + Intergenic
1137676605 16:50306676-50306698 CATGAGCTCTGCAGGGACCTTGG + Intronic
1139452374 16:67040855-67040877 GATGAGCCCTGCAGGGGTTGGGG + Intronic
1141141128 16:81497530-81497552 TTTGAGCCCTACGGGGCCTTAGG + Intronic
1141721667 16:85759429-85759451 GAGGAGCCGTGCCGGGCCTTGGG + Intergenic
1142000704 16:87662654-87662676 GCTGAGCCATGCGGAGAGTTTGG + Intronic
1143319531 17:6059258-6059280 GATGAGCCCTGGGGGGACTGGGG + Intronic
1146944064 17:36862365-36862387 CCTGAGGCCTGCGGGGACCTTGG + Intergenic
1146944881 17:36866813-36866835 GAGCAGCCCTGGGGGGACCTGGG + Intergenic
1151308748 17:73280585-73280607 GAAGTGCCCTGCGGGGCCCTAGG + Intergenic
1152749433 17:82055828-82055850 GAGGAGCCCTCTGGGGACTTGGG + Intronic
1152993352 18:383412-383434 GATGAGACATACGGGGAGTTGGG - Intronic
1154292594 18:13122660-13122682 GATGGGGCCTGCAGGGAGTTGGG + Intronic
1158941626 18:62410311-62410333 GATGAGCCCTGCCTCCACTTGGG - Intergenic
1160227059 18:77019752-77019774 TCTGGGCCCTGCGAGGACTTGGG + Intronic
1161453471 19:4359262-4359284 TAGGAGGTCTGCGGGGACTTGGG - Intronic
1161795430 19:6383599-6383621 GATGTGGCCCCCGGGGACTTGGG + Intronic
1164137236 19:22426601-22426623 GCTGAGTCCTGTAGGGACTTTGG + Intronic
1166803101 19:45469931-45469953 GATGAGCGCTGCTGAGGCTTGGG + Intronic
1167078255 19:47262132-47262154 GCTGAGCCCTGCAGGGAGGTGGG + Intronic
1202665474 1_KI270708v1_random:115154-115176 GATGAGCCCTACAGGGTCTTTGG + Intergenic
926994110 2:18715228-18715250 GAAAAGCCCAGTGGGGACTTGGG - Intergenic
928703773 2:33926052-33926074 GATTAGCCCTGAGGGCAATTGGG + Intergenic
929009128 2:37423846-37423868 GAAGAGGACTGCTGGGACTTGGG + Intergenic
931763356 2:65435075-65435097 GGTGATCCCAGTGGGGACTTGGG - Intergenic
932300475 2:70663513-70663535 GGTGAGCCCTCTGGGGACATGGG + Exonic
932562564 2:72886425-72886447 GATCAGCCCTGTGGGGAATTGGG + Intergenic
936626438 2:114154137-114154159 CATGAGACCTGCTGGGACTATGG + Intergenic
937225427 2:120366178-120366200 GAGGAACACTGAGGGGACTTTGG + Intergenic
938117708 2:128613119-128613141 GATGAGGCCTGAGGGGAAATTGG + Intergenic
941856914 2:170240612-170240634 GTTGAGCACTGAGGGGACTGGGG + Intronic
945362261 2:208906439-208906461 GAAGAGCCCTGGGGGCACTATGG + Intergenic
947529633 2:230900674-230900696 GAAGAGCCCTGAGAGGATTTTGG + Intergenic
1168913703 20:1469492-1469514 GATGAGCCCGGAGGGGGCTGGGG - Intronic
1168994769 20:2124970-2124992 GATGATCCCTGGGGGGCCATCGG - Intronic
1171387757 20:24781584-24781606 GATGAGCCCTGTGGGGAGGGCGG + Intergenic
1172951311 20:38724923-38724945 GGAGAGCCCTGCGGGGACGAGGG + Exonic
1173927739 20:46793203-46793225 GATGAGCCCTGCTGTGCCTATGG - Intergenic
1174379618 20:50148278-50148300 GATGATCCATGCTGTGACTTTGG - Intronic
1179803652 21:43824070-43824092 GAGGAGACCTACGAGGACTTGGG - Intergenic
1180040863 21:45278965-45278987 CAAGAGCCCTGGGGGGAGTTTGG - Intronic
1180193370 21:46179926-46179948 GATGAGCCCTCCTGTGACGTGGG + Intronic
1180332186 22:11492074-11492096 GATGAGCCCTACAGGGTCTTTGG + Intergenic
1180956862 22:19745127-19745149 GAAGAGCCCTGCCGGGACAAGGG + Intergenic
1183785832 22:40028619-40028641 GATGAGGCCTGCGGTTCCTTTGG - Intronic
1184785782 22:46671103-46671125 GATGGCCCCAGCTGGGACTTGGG + Intronic
950330484 3:12152391-12152413 GAGGAGCCCTGAGGGTCCTTTGG + Intronic
950496689 3:13338119-13338141 GTTGGGACCTGCGGGGCCTTGGG - Intronic
950714569 3:14838551-14838573 GATGAGACCTCTGGGGACCTTGG - Intronic
954143031 3:48620167-48620189 GCTGAGCCCTGAGGGGAAATGGG - Intergenic
957090431 3:75724352-75724374 GATGAGCCCTACAGGGTCTGTGG - Intronic
959461222 3:106628333-106628355 GTTGAGCCCTGCCTGGACTTTGG + Intergenic
961302547 3:125931483-125931505 GAGGAGCCCTGCGGTTACTGTGG - Intronic
961775235 3:129279325-129279347 GCTGACCCCAGCGGGGACTGGGG + Intronic
961885924 3:130096297-130096319 GAGGAGCCCTGCGGTTACTGTGG + Intronic
968442813 4:633153-633175 GATGAGCCCTCGGGGGACGCAGG + Intronic
968882039 4:3306056-3306078 GATGAGCCCTGCTCTGCCTTGGG + Intronic
973296452 4:48527727-48527749 AATGAGGCCTGCGGTGGCTTTGG - Intronic
984769691 4:183426707-183426729 GATGGGCCATGTGGGGACTTCGG - Intergenic
986710400 5:10484471-10484493 GAAGAGTCCTGCAGGCACTTGGG + Intergenic
997224414 5:132198165-132198187 GATGAGCCCTAAGGGGACCCTGG - Intronic
1002918570 6:1548677-1548699 GAGGAGTCCTGTGGGGACCTGGG + Intergenic
1003113202 6:3265754-3265776 GCTCAGCCCTGCGGGGAGTGAGG - Intronic
1003693119 6:8374439-8374461 GATGAGCCCTGGAGGGAGCTGGG + Intergenic
1010708779 6:79147117-79147139 GAGGAGTCCTGCAGGCACTTTGG + Intergenic
1012996638 6:105981676-105981698 GGTGCGGCCTGCGGGGCCTTTGG + Intergenic
1013995661 6:116304764-116304786 GATGAGGGCTGGGGGGACTCTGG - Intronic
1019435001 7:1018021-1018043 TCTGAGCCCCGTGGGGACTTTGG - Intronic
1020319373 7:6928767-6928789 GAGGAGCCCTGCGGTTACTGTGG + Intergenic
1022795888 7:33731121-33731143 GCTGAGCCCTGCTGGGATCTGGG + Intergenic
1025573186 7:62600745-62600767 TATGAGCCCTTTGGGGCCTTTGG - Intergenic
1030723595 7:112898585-112898607 AATGAATCCTGCAGGGACTTGGG - Intronic
1035289171 7:157826701-157826723 GCGGAGCCTGGCGGGGACTTGGG + Intronic
1035564978 8:635385-635407 GATGAGCCCTGCGGGGACTTTGG - Intronic
1036847630 8:12180613-12180635 GAGGAGCCCTGCGGTTACTGTGG + Intergenic
1036868998 8:12422928-12422950 GAGGAGCCCTGCGGTTACTGTGG + Intergenic
1037785328 8:21899596-21899618 GATGAGCCTTGCGGGAAGTAAGG - Intergenic
1038451215 8:27640044-27640066 GAAGAGGCATGGGGGGACTTGGG + Intronic
1040969088 8:53114443-53114465 GCAGAGCCCTGCTGGCACTTGGG - Intergenic
1042995428 8:74693258-74693280 GAAGAGCCCTGTGGGCACTCTGG + Intronic
1044907776 8:97023745-97023767 AATAAGCCCTGTGGAGACTTGGG - Intronic
1045600325 8:103707820-103707842 GGTGAAACCTGCTGGGACTTGGG + Intronic
1049601904 8:143511876-143511898 GATGAAGCCTGCGGAGGCTTGGG - Intronic
1051342965 9:16128481-16128503 GCCCAGCCCTGCGGGGACCTGGG - Intergenic
1051406531 9:16743598-16743620 CATCAGCCCTGCGGGTGCTTTGG - Intronic
1051991782 9:23161155-23161177 AATAAGACCTGCTGGGACTTGGG + Intergenic
1052542825 9:29832902-29832924 GCTGAGCTCTGCAAGGACTTAGG + Intergenic
1057144170 9:92747399-92747421 CAGGAGCCTGGCGGGGACTTTGG - Intronic
1060971618 9:127741723-127741745 GAAGAGCCCTGGGGTGCCTTTGG - Intronic
1062527904 9:136985656-136985678 GCTGACCCCTGCGGGCACTCAGG - Exonic
1203487151 Un_GL000224v1:67489-67511 GATGAGCCCTACAGGGTCTGTGG + Intergenic
1203499772 Un_KI270741v1:9389-9411 GATGAGCCCTACAGGGTCTGTGG + Intergenic
1188684689 X:33055256-33055278 GATGAGGCCTGATGTGACTTGGG + Intronic
1196550309 X:117016771-117016793 GATCAAACCTGCAGGGACTTGGG + Intergenic
1198815029 X:140580547-140580569 GAAGAGCCCTGGGGGGACCAGGG - Intergenic