ID: 1035564979

View in Genome Browser
Species Human (GRCh38)
Location 8:635392-635414
Sequence TAGTGGTGATGAGCCCTGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 71}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035564979_1035564985 10 Left 1035564979 8:635392-635414 CCCCGCAGGGCTCATCACCACTA 0: 1
1: 0
2: 1
3: 7
4: 71
Right 1035564985 8:635425-635447 CAGCTAAGGCTGGCTGTGAGAGG No data
1035564979_1035564988 21 Left 1035564979 8:635392-635414 CCCCGCAGGGCTCATCACCACTA 0: 1
1: 0
2: 1
3: 7
4: 71
Right 1035564988 8:635436-635458 GGCTGTGAGAGGGGCTGTCTAGG No data
1035564979_1035564989 22 Left 1035564979 8:635392-635414 CCCCGCAGGGCTCATCACCACTA 0: 1
1: 0
2: 1
3: 7
4: 71
Right 1035564989 8:635437-635459 GCTGTGAGAGGGGCTGTCTAGGG No data
1035564979_1035564983 -4 Left 1035564979 8:635392-635414 CCCCGCAGGGCTCATCACCACTA 0: 1
1: 0
2: 1
3: 7
4: 71
Right 1035564983 8:635411-635433 ACTAACAATAGTGACAGCTAAGG No data
1035564979_1035564986 11 Left 1035564979 8:635392-635414 CCCCGCAGGGCTCATCACCACTA 0: 1
1: 0
2: 1
3: 7
4: 71
Right 1035564986 8:635426-635448 AGCTAAGGCTGGCTGTGAGAGGG No data
1035564979_1035564987 12 Left 1035564979 8:635392-635414 CCCCGCAGGGCTCATCACCACTA 0: 1
1: 0
2: 1
3: 7
4: 71
Right 1035564987 8:635427-635449 GCTAAGGCTGGCTGTGAGAGGGG No data
1035564979_1035564984 0 Left 1035564979 8:635392-635414 CCCCGCAGGGCTCATCACCACTA 0: 1
1: 0
2: 1
3: 7
4: 71
Right 1035564984 8:635415-635437 ACAATAGTGACAGCTAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035564979 Original CRISPR TAGTGGTGATGAGCCCTGCG GGG (reversed) Intronic
900325659 1:2107624-2107646 GAGGGAGGATGAGCCCTGCGAGG + Intronic
900636366 1:3667937-3667959 CAGTGGCCATGAGCCCTGGGGGG - Intronic
902856799 1:19212411-19212433 TAGTGATGAGGAGGCCTGCTGGG + Intergenic
904268332 1:29331045-29331067 CAGTGGAGATGAGCCCAGCTAGG - Intergenic
906128349 1:43441390-43441412 TGGTGGTGGTGTGCCCTGGGAGG + Intronic
907023089 1:51087466-51087488 CAGTGGTGATGAGGGCTGCTGGG + Intergenic
907239632 1:53074346-53074368 GAGTGGGGATGACCCCTGAGAGG - Intronic
911965327 1:104361353-104361375 TAGTGGTGATGAGCTCTTTTAGG - Intergenic
912376250 1:109212248-109212270 CAGTGGTGAGGGGCCCTGGGGGG + Intergenic
920138476 1:203789962-203789984 CAGTGGTGATGAACACTGTGGGG + Intergenic
921391512 1:214619531-214619553 TAGTCGTGATGCTCCCTGCCTGG + Intronic
1071592749 10:86891162-86891184 TGGTGGTGGTGGGCTCTGCGTGG + Intronic
1084888467 11:72224959-72224981 GGGCGGTGCTGAGCCCTGCGCGG + Exonic
1089515329 11:119028412-119028434 TGCTGGTGATGAACCCTGCAGGG + Exonic
1094475750 12:30839450-30839472 TCATGTTGATGAGCCCTGAGGGG - Intergenic
1098977628 12:76919829-76919851 TGGTGGTGGTGAGCCCTTTGTGG + Intergenic
1102651215 12:114443914-114443936 TGGCGCTGATGAGCGCTGCGCGG + Intergenic
1105064506 12:133184891-133184913 TAGTGGTGATGGGCTGTGTGTGG + Intronic
1117584581 14:57187305-57187327 TAGAGGTGATGAGAGCTGCGTGG + Intergenic
1117777693 14:59199386-59199408 AAGTGGTGATCAGCCCTGCACGG - Intronic
1118096666 14:62545344-62545366 TAGTGGTGGTGAGCCCAAGGAGG + Intergenic
1118716652 14:68564644-68564666 TGGTGGTGGGGAGCCCTGTGAGG - Intronic
1118834998 14:69471399-69471421 AAGTGGGGATGAGCCAGGCGTGG - Intergenic
1120711507 14:87797929-87797951 TATTGGTGCTGAGTCCTGCAGGG + Intergenic
1121091941 14:91188980-91189002 CAGTGGTGATGAGCACTGAGCGG - Exonic
1121789771 14:96690356-96690378 AAGGGGTGGTGAGCCCTGCTGGG - Intergenic
1122835589 14:104429330-104429352 CAGTGGTGAGGTGCCCTGGGCGG + Intergenic
1124267544 15:28250307-28250329 TGGTGGTGGTGAGCCCAGTGAGG - Intronic
1124653276 15:31488135-31488157 AGGTGGTGATGAGCCCTGGAAGG + Intronic
1133057230 16:3151531-3151553 TAGTGGTGATGAGCCGGGCGCGG + Intergenic
1136184002 16:28574408-28574430 TTCTGGTGATGTGCCCTGGGAGG + Intronic
1136356491 16:29747642-29747664 TGGTGGTTTTGAGCCCTGCTGGG + Intergenic
1139371735 16:66473324-66473346 TGGTGGTGGTGACCCCTGTGGGG + Intronic
1152422007 17:80198584-80198606 TTGTGATGGTGAGCCGTGCGAGG + Exonic
1162281186 19:9699215-9699237 TAGAGGTAATGAGCCAGGCGCGG - Intronic
1163390095 19:17025675-17025697 TAGTGGTTCTCAGCCCTGGGGGG - Intronic
1163443563 19:17333878-17333900 GAGTGGTGAGGAGCCCTGGCGGG - Intronic
1164853580 19:31503730-31503752 AAGTGCTGATGAGCTCTCCGCGG - Intergenic
1165323154 19:35098760-35098782 TGGTGGCGCTGAGCCCTGCCAGG + Intergenic
935933444 2:108154854-108154876 TAGCGCTGATGAGCCCAGGGTGG - Intergenic
938030336 2:127986820-127986842 CCGTGGCGATGAGCCCTGGGCGG + Exonic
941649035 2:168073570-168073592 CAGGGGTGATGAGCCCCACGTGG - Intronic
948317211 2:237037386-237037408 TAGTGGTGGTGTCCCCTGCTGGG + Intergenic
948406320 2:237722755-237722777 GAGTGGTGAAGAGGCCTGCGTGG + Intronic
948433334 2:237934650-237934672 TACAGGCGATGAGCACTGCGTGG - Intergenic
1181651524 22:24261685-24261707 GGGTGCTGCTGAGCCCTGCGAGG - Intergenic
1184840348 22:47048811-47048833 TAGGGGTGAGGGGCCCTGCACGG + Intronic
954001751 3:47563083-47563105 ATGTGTTGATGAGCTCTGCGGGG + Intronic
959650346 3:108745002-108745024 TGGTGATGATGTGCCCTGCATGG + Intronic
961543903 3:127618823-127618845 TTGTGGAGATGAGCCCTGTGGGG + Intronic
969670465 4:8587367-8587389 TGGGGGCGATGAGCCCTGCCAGG - Exonic
971099490 4:23447598-23447620 CAGTGGTGATGAGCACTTGGGGG + Intergenic
973881266 4:55273641-55273663 TAGTGGTGAAAAGCTTTGCGGGG + Intergenic
982063504 4:151628423-151628445 AAGTGTAGATGAGCCCTGAGTGG - Intronic
982350370 4:154408836-154408858 AAGTGGTGATGAGGACTGCTGGG - Intronic
983099949 4:163612963-163612985 TCATGGTGCTGAGCCCTGCTAGG - Intronic
985042751 4:185908042-185908064 TAGTGGTGAGGAGCTCAGCATGG - Intronic
990339501 5:54808524-54808546 CAGTGGTGAAGAGCCCAGTGTGG - Intergenic
1001061441 5:168493132-168493154 TGGTGGTGATGAGTGCTGGGAGG + Intronic
1002271101 5:178072949-178072971 TGGTGGTGCTGAGTCTTGCGTGG - Intergenic
1004395456 6:15244018-15244040 TAGTGGTGATCAAACCTGTGGGG - Intergenic
1006897050 6:37477898-37477920 TAGTTACGATGGGCCCTGCGAGG + Intronic
1012692589 6:102333877-102333899 GAGTTGTGATGAGCCCTTCTGGG + Intergenic
1019861101 7:3658906-3658928 TAGTGGTGATGGGCCAGGCATGG - Intronic
1027232698 7:76281843-76281865 TAGTGGAGGGGAGCCCTGTGCGG - Intronic
1032268566 7:130384665-130384687 CAGTGGTGAGGAGCCATTCGAGG - Intronic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1037846046 8:22283150-22283172 TGGTGGTGATGACAGCTGCGGGG - Exonic
1038427297 8:27472090-27472112 GAGGGGTGATGAGCCCAGCGAGG + Intronic
1040886298 8:52267160-52267182 CAGTGGGGATGAACCCTGAGGGG + Intronic
1043514953 8:80987321-80987343 CAGAGGTGATGAGGCCTGTGTGG + Intronic
1050416367 9:5421418-5421440 TAGTGGTGATGAGTTCTGTGAGG - Intronic
1057401511 9:94727102-94727124 GACTGGAGATGAGCCCTGTGGGG - Intronic
1057516425 9:95725660-95725682 GAGTCGTGAAGAGCCCAGCGGGG + Intergenic
1061213223 9:129205408-129205430 TAGTGGTGGTGGGCACTGAGTGG + Intergenic
1061354369 9:130093053-130093075 TAGTGACGATGAGCACTGCCTGG + Intronic
1193244603 X:79213170-79213192 TAGTGATGTTGAGCACTGCATGG - Intergenic
1198714743 X:139545073-139545095 TGGTGGTGATTAGCTCTGGGTGG - Intronic
1202369494 Y:24187343-24187365 CAGTGGTGATGTGGCCTGGGAGG - Intergenic
1202501291 Y:25482774-25482796 CAGTGGTGATGTGGCCTGGGAGG + Intergenic