ID: 1035564980

View in Genome Browser
Species Human (GRCh38)
Location 8:635393-635415
Sequence TTAGTGGTGATGAGCCCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 141}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035564980_1035564984 -1 Left 1035564980 8:635393-635415 CCCGCAGGGCTCATCACCACTAA 0: 1
1: 0
2: 0
3: 5
4: 141
Right 1035564984 8:635415-635437 ACAATAGTGACAGCTAAGGCTGG No data
1035564980_1035564985 9 Left 1035564980 8:635393-635415 CCCGCAGGGCTCATCACCACTAA 0: 1
1: 0
2: 0
3: 5
4: 141
Right 1035564985 8:635425-635447 CAGCTAAGGCTGGCTGTGAGAGG No data
1035564980_1035564987 11 Left 1035564980 8:635393-635415 CCCGCAGGGCTCATCACCACTAA 0: 1
1: 0
2: 0
3: 5
4: 141
Right 1035564987 8:635427-635449 GCTAAGGCTGGCTGTGAGAGGGG No data
1035564980_1035564989 21 Left 1035564980 8:635393-635415 CCCGCAGGGCTCATCACCACTAA 0: 1
1: 0
2: 0
3: 5
4: 141
Right 1035564989 8:635437-635459 GCTGTGAGAGGGGCTGTCTAGGG No data
1035564980_1035564988 20 Left 1035564980 8:635393-635415 CCCGCAGGGCTCATCACCACTAA 0: 1
1: 0
2: 0
3: 5
4: 141
Right 1035564988 8:635436-635458 GGCTGTGAGAGGGGCTGTCTAGG No data
1035564980_1035564983 -5 Left 1035564980 8:635393-635415 CCCGCAGGGCTCATCACCACTAA 0: 1
1: 0
2: 0
3: 5
4: 141
Right 1035564983 8:635411-635433 ACTAACAATAGTGACAGCTAAGG No data
1035564980_1035564986 10 Left 1035564980 8:635393-635415 CCCGCAGGGCTCATCACCACTAA 0: 1
1: 0
2: 0
3: 5
4: 141
Right 1035564986 8:635426-635448 AGCTAAGGCTGGCTGTGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035564980 Original CRISPR TTAGTGGTGATGAGCCCTGC GGG (reversed) Intronic
900722248 1:4184743-4184765 TGAGTGGTGATTAGGCCTGGTGG + Intergenic
902051173 1:13564701-13564723 TGAGTGGTGATTAGGCCTGGTGG - Intergenic
902856798 1:19212410-19212432 GTAGTGATGAGGAGGCCTGCTGG + Intergenic
904899634 1:33846809-33846831 GGAGAGGTGATGAGCCCTCCAGG + Intronic
905863051 1:41362992-41363014 TCACTGGTGATGGCCCCTGCTGG + Intronic
907023088 1:51087465-51087487 TCAGTGGTGATGAGGGCTGCTGG + Intergenic
907491573 1:54812013-54812035 GCAGAGGTGATGAGGCCTGCAGG - Intronic
909626688 1:77724858-77724880 TTAGTAGAGATGGGCCATGCTGG - Intronic
909788006 1:79640448-79640470 TGTGTGGTGATGAGGCCTGGTGG + Intergenic
911967228 1:104384335-104384357 TGAGTGGTGATTAGGCCTGGTGG - Intergenic
922355504 1:224771541-224771563 TTAGTGGTGTTGAGGGCTGTTGG + Intergenic
924548815 1:245054971-245054993 TTCCTGGTGATGGGCCCAGCTGG + Intronic
1063833065 10:9978860-9978882 TTATTGGGGATGAGTCATGCAGG - Intergenic
1066436882 10:35403848-35403870 TGAGTGGTGATTAGGCCTGGTGG + Intronic
1069893154 10:71664457-71664479 GAAGTGGTGCTAAGCCCTGCAGG - Intronic
1075633585 10:124015912-124015934 GGAGTGGTGACGAGCCCTGGTGG + Intronic
1075893802 10:125977752-125977774 TGTCTGGTGATGAGCCATGCTGG + Intronic
1076109822 10:127851778-127851800 CTAGAGGGGATGGGCCCTGCTGG - Intergenic
1078774771 11:14383834-14383856 TTAGCTCTGATGAGCTCTGCAGG - Intergenic
1084354518 11:68628510-68628532 TGAGTGGTGATTAGGCCTGGTGG - Intergenic
1085838302 11:79980199-79980221 TTAGTGAAGAACAGCCCTGCTGG - Intergenic
1086878983 11:92131968-92131990 ATAGTTTAGATGAGCCCTGCGGG - Intergenic
1088180308 11:107102647-107102669 TTAGTGGGGATGAGCCCCATTGG + Intergenic
1088662310 11:112059940-112059962 ATAGGTGTGATGAGTCCTGCAGG - Exonic
1089515328 11:119028411-119028433 CTGCTGGTGATGAACCCTGCAGG + Exonic
1089905182 11:122031211-122031233 TTAGTGGTGATGGGAGGTGCAGG + Intergenic
1090526512 11:127544244-127544266 TGTGTGGTGATGAGGCCTGGTGG + Intergenic
1091641976 12:2244280-2244302 CTAGTGGTAATGAGCACAGCAGG - Intronic
1094475751 12:30839451-30839473 TTCATGTTGATGAGCCCTGAGGG - Intergenic
1095941775 12:47732179-47732201 TTGCTGGGGCTGAGCCCTGCAGG - Intergenic
1097849195 12:64394801-64394823 TTAGTGGAGAAGAGACCAGCAGG + Intergenic
1099269287 12:80487187-80487209 TTAGATGTAATGAGCCCTGGTGG - Intronic
1101195200 12:102374576-102374598 TGAGTTGAGATGAGGCCTGCAGG + Intergenic
1103251229 12:119501726-119501748 TTAGTGGTGAATATCCCTGAAGG - Intronic
1104888967 12:132130640-132130662 TTGGCGGTGATGATCCCTGGAGG + Intronic
1106944419 13:34811001-34811023 TTAGTGGTGCTGAGTCAGGCAGG - Intergenic
1109222139 13:59650980-59651002 TTAGTGGTGATGATCTTTGGTGG + Intergenic
1113089105 13:106598334-106598356 TTAGTGGAGATCAGCACTGCTGG - Intergenic
1114686116 14:24533434-24533456 TTAGTTCTGGTGAGCCCTGGGGG + Intergenic
1116490321 14:45497097-45497119 TGAGTGGTGATTAGGCCTGGTGG + Intergenic
1120203450 14:81562987-81563009 GGAGGAGTGATGAGCCCTGCTGG + Intergenic
1120711506 14:87797928-87797950 CTATTGGTGCTGAGTCCTGCAGG + Intergenic
1120847275 14:89137756-89137778 TTAGGGGTGGTGAGTCATGCTGG + Intronic
1121343032 14:93116165-93116187 TTGGGGGTGCTGAACCCTGCTGG - Intronic
1121789772 14:96690357-96690379 CAAGGGGTGGTGAGCCCTGCTGG - Intergenic
1121980340 14:98448990-98449012 TGAGTGGTGATTAGGCCTGGTGG + Intergenic
1125605472 15:40937663-40937685 TTAGTGGCAATGAGGCCAGCAGG - Intronic
1128080304 15:64853235-64853257 TGAGTGGGGATGAGGCCTGGGGG + Intronic
1128532371 15:68463292-68463314 TCATTGGTGAGGAGCCCTCCAGG + Intergenic
1129228665 15:74184467-74184489 TGAGTGGTGAGGAGCACTGAAGG - Intronic
1135025147 16:18993933-18993955 TGAGTGGTGATTAGGCCTGGTGG + Intronic
1136356490 16:29747641-29747663 CTGGTGGTTTTGAGCCCTGCTGG + Intergenic
1143308863 17:5971813-5971835 TTAGAGGCAATGAGCCCTGATGG - Intronic
1145080413 17:19890334-19890356 TGAGTGGTGATTAGGCCTGGTGG + Intergenic
1146454606 17:32999083-32999105 AGAGTGGTGAAGAACCCTGCTGG + Intergenic
1149220808 17:54413717-54413739 TGAGTGGTGATTAGGCCTGGTGG - Intergenic
1151503038 17:74504562-74504584 TGAGTGGTGATTAGGCCTGGTGG - Intergenic
1151839484 17:76607675-76607697 TGTGTGGTGATTAGGCCTGCTGG + Intergenic
1154230427 18:12551762-12551784 TTATTGATCATCAGCCCTGCAGG + Intronic
1155591909 18:27436857-27436879 TCAATGGTGAAGAGCCCTGGAGG - Intergenic
1155631895 18:27904250-27904272 TCAGTGGAGATGAGGCCTTCAGG - Intergenic
1155892504 18:31286453-31286475 TGAGTGGCGATGAGGCCTGGTGG + Intergenic
1156713442 18:39976914-39976936 TGAGTGGAGTTGAGTCCTGCAGG - Intergenic
1159067623 18:63587706-63587728 TTAGCGGGGATGAGCCCTTGAGG + Intronic
1163443564 19:17333879-17333901 GGAGTGGTGAGGAGCCCTGGCGG - Intronic
1163899889 19:20091960-20091982 TGAGTGGTGATTAGGCCTGGTGG + Intronic
1164220325 19:23187461-23187483 TGAGTGGTGATTAGGCCTGGTGG - Intergenic
1165055371 19:33173218-33173240 TTGGAGGGGATGAGACCTGCAGG + Intronic
926600889 2:14844343-14844365 TTAGTCATTATGAGTCCTGCTGG - Intergenic
926990826 2:18677745-18677767 TGAGTGGGGATGCGCCCTGTTGG - Intergenic
930331124 2:49985675-49985697 TGACTGGTGATGTGTCCTGCAGG - Intronic
930556099 2:52897539-52897561 ACAGTGGTGTTGACCCCTGCAGG + Intergenic
933001257 2:76926565-76926587 TTAGTGGTGATTAGGCCAGGAGG + Intronic
934769372 2:96898249-96898271 TTCATGGTGAAGTGCCCTGCTGG - Intronic
934926957 2:98388775-98388797 TCAGTGGTGATGAGAGCTGTAGG + Intronic
941677325 2:168357481-168357503 TCTGTGGGGATGAGCTCTGCTGG - Intergenic
942813604 2:180025132-180025154 AGAGTGGTCATGAGCCCTGGTGG - Intergenic
946548676 2:220776211-220776233 TTTGTGCTGAAGAGCCCTACTGG + Intergenic
948119872 2:235522134-235522156 TTAGGGGTGATGAGGCTTCCTGG + Intronic
948317210 2:237037385-237037407 ATAGTGGTGGTGTCCCCTGCTGG + Intergenic
1169130982 20:3166345-3166367 CTAGTGGTTCTGAGCACTGCAGG + Exonic
1177039799 21:16094440-16094462 TGGGTGGTGGGGAGCCCTGCTGG + Intergenic
1183632690 22:39042865-39042887 TTAGTGGACATCAGCCCTGAGGG + Intronic
1184746619 22:46459886-46459908 TTAGTGGTGCTCTGCTCTGCTGG - Intronic
949789811 3:7780880-7780902 TGTGTTGTGATGAGCCCTCCAGG + Intergenic
951191861 3:19781181-19781203 TCAGGGATGATGAGACCTGCAGG + Intergenic
954163876 3:48740650-48740672 TGACTGGTGAAGAGTCCTGCTGG + Intergenic
955067733 3:55547214-55547236 TCAGTGGTGGTGGGCCCGGCTGG - Intronic
956643735 3:71436429-71436451 CTGGTGGTGATGAGACCTTCTGG + Intronic
960992799 3:123322785-123322807 TTAAAAGTGATGAGCCGTGCTGG - Intronic
961543902 3:127618822-127618844 CTTGTGGAGATGAGCCCTGTGGG + Intronic
964940659 3:162155644-162155666 TGAGTGGTGATTAGGCCTGGTGG + Intergenic
968350252 3:198047242-198047264 TGGGGGGTGATGAGCGCTGCTGG - Intergenic
982350371 4:154408837-154408859 AAAGTGGTGATGAGGACTGCTGG - Intronic
983883464 4:172957878-172957900 TGAGTGGTGATTAGGCCTGGTGG + Intronic
985078735 4:186243870-186243892 TGAGTGGTGATTAGGCCTGGTGG + Intronic
986368655 5:7059653-7059675 TGAGTGGTGATTAGGCCTGGTGG + Intergenic
987443848 5:17991853-17991875 TTACTGGTGATGAACCCTTGTGG + Intergenic
994295401 5:98083062-98083084 TGAGTGGTGATTAGGCCTGGCGG - Intergenic
998013805 5:138716530-138716552 TTATTTCTGGTGAGCCCTGCTGG - Intronic
1000056736 5:157613770-157613792 CCAGTGAGGATGAGCCCTGCAGG + Intergenic
1000634881 5:163632683-163632705 TTAGGAGTGATGAGGCATGCAGG - Intergenic
1004395457 6:15244019-15244041 TTAGTGGTGATCAAACCTGTGGG - Intergenic
1006514042 6:34536282-34536304 TTAGTGATGGGGAGCCCTGAGGG + Intergenic
1007300666 6:40865613-40865635 TGAGTGGTGATTAGGCCTGGTGG + Intergenic
1007626785 6:43251210-43251232 TTAGTGGTGATTGACACTGCGGG - Intronic
1009464641 6:63954248-63954270 TGAGTGGTGATTAGGCCTGGTGG - Intronic
1010586431 6:77662269-77662291 TGAGTGGTGATTAGGCCTGGTGG + Intergenic
1012692588 6:102333876-102333898 AGAGTTGTGATGAGCCCTTCTGG + Intergenic
1013037221 6:106397692-106397714 TTAGTGGTGATATGCCCCGCTGG - Intergenic
1013251202 6:108335164-108335186 TTAGTAGAGATGAGCCAGGCTGG + Intronic
1013807788 6:114013833-114013855 TTAGTGGCGATTAGGCCTGGTGG + Intergenic
1017175233 6:151496246-151496268 TTATTGGTGATGTCCCCAGCTGG + Intronic
1021172977 7:17418080-17418102 TGAGTGGTGATTAGGCCTGGTGG - Intergenic
1023054962 7:36283845-36283867 AGAGTGGTGATGAGCACTGCTGG + Intronic
1024084610 7:45883021-45883043 CTGGTGGTGATGAGACCTACTGG + Intergenic
1026024640 7:66734617-66734639 TTAGTAGAGATGAGCCATGTTGG + Intronic
1026944753 7:74308370-74308392 CTTGTGGTGATCAGCCCAGCTGG - Intronic
1028914664 7:96244709-96244731 GTAGAGCTGAAGAGCCCTGCTGG - Intronic
1029317488 7:99727636-99727658 TGAGTGGTGATTAGGCCTGGTGG - Intronic
1031354934 7:120778857-120778879 TTAGTGGCGATTAGGCCTGGTGG + Intergenic
1032883604 7:136115493-136115515 GAAGTTGTGATGGGCCCTGCAGG + Intergenic
1034842500 7:154412332-154412354 TTGCTGGAGATTAGCCCTGCTGG - Intronic
1035564980 8:635393-635415 TTAGTGGTGATGAGCCCTGCGGG - Intronic
1035608402 8:944658-944680 TGGGTGGTAATGATCCCTGCGGG + Intergenic
1035608436 8:944817-944839 TGGGTGGTAATGATCCCTGCGGG + Intergenic
1036472072 8:9061157-9061179 TGAGTGGCGATTAGGCCTGCTGG + Intronic
1038950445 8:32408517-32408539 TTAAAGGTAATGAGCCCAGCAGG - Intronic
1046281102 8:112033062-112033084 TTAGTAGAGATGAGCCAGGCTGG + Intergenic
1046317233 8:112520407-112520429 ATAATGGTTAAGAGCCCTGCTGG - Intronic
1047007163 8:120632376-120632398 TTAGTGGTTATGAGCGCTGGGGG + Intronic
1049417676 8:142502946-142502968 GTAGTGGTGGTGAGACCTGGTGG + Intronic
1049714202 8:144082294-144082316 TCAGAGGTGATGAGCCGGGCAGG - Intergenic
1052642940 9:31192754-31192776 TCAGAGGTGTTGAGCCCTGTTGG + Intergenic
1053086772 9:35231180-35231202 TTCGTGGTGATCAGCCTTCCTGG + Exonic
1054878469 9:70121060-70121082 TCAGCTGTGATGCGCCCTGCTGG - Intronic
1057572828 9:96217466-96217488 TAAGTGCTGATAAGGCCTGCGGG + Intergenic
1192550068 X:72046513-72046535 TTAGCGATAATGAGCACTGCCGG - Intergenic
1193739635 X:85202735-85202757 TTTCTGGTGATGAGCCATGGAGG + Intergenic
1194602084 X:95934534-95934556 TTACTGATGATGAGACCTGAAGG - Intergenic
1196220721 X:113110436-113110458 TGAGTGGTGATTAGGCCTGGTGG + Intergenic
1196812065 X:119636740-119636762 TGTGTGGTGATCAGCCTTGCTGG + Intronic
1199377637 X:147132643-147132665 TGAGTGGTGATTAGGCCTGGTGG + Intergenic
1199495955 X:148452534-148452556 TTAGTCGTCATGGGCCCTTCAGG - Intergenic
1200813132 Y:7504938-7504960 TGAGTGGTGATTAGGCCTGGTGG - Intergenic
1201233990 Y:11892632-11892654 TGAGTGGTGATTAGGCCTGATGG + Intergenic
1202062285 Y:20900076-20900098 TGAGTGGTGATTAGGCCTGGTGG - Intergenic