ID: 1035564980

View in Genome Browser
Species Human (GRCh38)
Location 8:635393-635415
Sequence TTAGTGGTGATGAGCCCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035564980_1035564988 20 Left 1035564980 8:635393-635415 CCCGCAGGGCTCATCACCACTAA No data
Right 1035564988 8:635436-635458 GGCTGTGAGAGGGGCTGTCTAGG No data
1035564980_1035564986 10 Left 1035564980 8:635393-635415 CCCGCAGGGCTCATCACCACTAA No data
Right 1035564986 8:635426-635448 AGCTAAGGCTGGCTGTGAGAGGG No data
1035564980_1035564989 21 Left 1035564980 8:635393-635415 CCCGCAGGGCTCATCACCACTAA No data
Right 1035564989 8:635437-635459 GCTGTGAGAGGGGCTGTCTAGGG No data
1035564980_1035564983 -5 Left 1035564980 8:635393-635415 CCCGCAGGGCTCATCACCACTAA No data
Right 1035564983 8:635411-635433 ACTAACAATAGTGACAGCTAAGG No data
1035564980_1035564987 11 Left 1035564980 8:635393-635415 CCCGCAGGGCTCATCACCACTAA No data
Right 1035564987 8:635427-635449 GCTAAGGCTGGCTGTGAGAGGGG No data
1035564980_1035564985 9 Left 1035564980 8:635393-635415 CCCGCAGGGCTCATCACCACTAA No data
Right 1035564985 8:635425-635447 CAGCTAAGGCTGGCTGTGAGAGG No data
1035564980_1035564984 -1 Left 1035564980 8:635393-635415 CCCGCAGGGCTCATCACCACTAA No data
Right 1035564984 8:635415-635437 ACAATAGTGACAGCTAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035564980 Original CRISPR TTAGTGGTGATGAGCCCTGC GGG (reversed) Intronic