ID: 1035564981

View in Genome Browser
Species Human (GRCh38)
Location 8:635394-635416
Sequence GTTAGTGGTGATGAGCCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 148}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035564981_1035564984 -2 Left 1035564981 8:635394-635416 CCGCAGGGCTCATCACCACTAAC 0: 1
1: 0
2: 1
3: 9
4: 148
Right 1035564984 8:635415-635437 ACAATAGTGACAGCTAAGGCTGG No data
1035564981_1035564988 19 Left 1035564981 8:635394-635416 CCGCAGGGCTCATCACCACTAAC 0: 1
1: 0
2: 1
3: 9
4: 148
Right 1035564988 8:635436-635458 GGCTGTGAGAGGGGCTGTCTAGG No data
1035564981_1035564983 -6 Left 1035564981 8:635394-635416 CCGCAGGGCTCATCACCACTAAC 0: 1
1: 0
2: 1
3: 9
4: 148
Right 1035564983 8:635411-635433 ACTAACAATAGTGACAGCTAAGG No data
1035564981_1035564987 10 Left 1035564981 8:635394-635416 CCGCAGGGCTCATCACCACTAAC 0: 1
1: 0
2: 1
3: 9
4: 148
Right 1035564987 8:635427-635449 GCTAAGGCTGGCTGTGAGAGGGG No data
1035564981_1035564986 9 Left 1035564981 8:635394-635416 CCGCAGGGCTCATCACCACTAAC 0: 1
1: 0
2: 1
3: 9
4: 148
Right 1035564986 8:635426-635448 AGCTAAGGCTGGCTGTGAGAGGG No data
1035564981_1035564989 20 Left 1035564981 8:635394-635416 CCGCAGGGCTCATCACCACTAAC 0: 1
1: 0
2: 1
3: 9
4: 148
Right 1035564989 8:635437-635459 GCTGTGAGAGGGGCTGTCTAGGG No data
1035564981_1035564985 8 Left 1035564981 8:635394-635416 CCGCAGGGCTCATCACCACTAAC 0: 1
1: 0
2: 1
3: 9
4: 148
Right 1035564985 8:635425-635447 CAGCTAAGGCTGGCTGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035564981 Original CRISPR GTTAGTGGTGATGAGCCCTG CGG (reversed) Intronic
900636368 1:3667939-3667961 GACAGTGGCCATGAGCCCTGGGG - Intronic
902126822 1:14221101-14221123 CTTAGTGTTTATTAGCCCTGAGG + Intergenic
902444368 1:16452659-16452681 GTTTGTGCTGAGGAGCCCTTAGG + Intronic
902612780 1:17607065-17607087 ATTTGGGGTGAGGAGCCCTGAGG + Intronic
907418864 1:54333078-54333100 TTCAGTGGTGATGGTCCCTGCGG - Intronic
909116077 1:71538569-71538591 GTTAGTGCTGATGAAGCCTCAGG + Intronic
915079406 1:153341573-153341595 GTTAGTTGGGGTGAGCCCAGTGG + Intronic
915892260 1:159782986-159783008 GTAAGAGGTGACCAGCCCTGTGG - Intergenic
920138474 1:203789960-203789982 GACAGTGGTGATGAACACTGTGG + Intergenic
921859427 1:220026220-220026242 GTTGGTGCTGATGAGACCTTTGG - Intronic
922347594 1:224709181-224709203 GTTGGAGGAGATGAGCCCTGGGG - Intronic
924451502 1:244182818-244182840 ATTAGTGGTGAAGAACCCTGTGG + Intergenic
1062896668 10:1108691-1108713 GTTGGTGGTTGTGATCCCTGTGG + Intronic
1068070915 10:52194148-52194170 GTTATTGGTGGTGAGTCTTGGGG - Intronic
1072262995 10:93700054-93700076 TTTAGTGATGATGAACGCTGTGG - Exonic
1073539673 10:104307928-104307950 GTCAGTGGTGTTCAGCCCTCTGG - Intergenic
1074578910 10:114697376-114697398 GCAAGTGGTGATCAGCCCTCAGG + Intergenic
1075672656 10:124273082-124273104 GGCAGTGGAGATGAGCCCTCTGG - Intergenic
1075766098 10:124894256-124894278 GTTTGTGTTTATGAGCCCAGAGG - Intergenic
1076298515 10:129405902-129405924 CTTAATGGTGCTGAGCCCTCTGG - Intergenic
1076581402 10:131514369-131514391 GTTTGAGGTGATAAGCTCTGCGG + Intergenic
1077291475 11:1797013-1797035 TTTGTTGGTGATGAGGCCTGGGG + Intergenic
1081484536 11:43517303-43517325 GTCAGTGGTGGGGAGACCTGAGG - Intergenic
1083852475 11:65376398-65376420 GCTGGTGGGGATGAGCCCTGCGG - Exonic
1085264067 11:75225985-75226007 CTCAGTGGTGAGGAGCACTGAGG - Intergenic
1085476672 11:76793621-76793643 TTTGGTGGTAATGAGCCCTGCGG + Intronic
1085542641 11:77286759-77286781 GCTAGTGGTGATTTTCCCTGAGG - Intronic
1086878984 11:92131969-92131991 GATAGTTTAGATGAGCCCTGCGG - Intergenic
1087050887 11:93885384-93885406 GATAGTGGTTATGAGAGCTGGGG + Intergenic
1088466893 11:110149259-110149281 GTTAGTGGGGATGAGCAGGGTGG - Intronic
1091818688 12:3458392-3458414 GTTAAGAGTGAGGAGCCCTGGGG - Intronic
1094475752 12:30839452-30839474 GTTCATGTTGATGAGCCCTGAGG - Intergenic
1095739665 12:45593230-45593252 GTGAGAGGCGTTGAGCCCTGGGG + Intergenic
1097544050 12:60976416-60976438 GTTATTTGTGGTGAGACCTGAGG - Intergenic
1099857420 12:88184125-88184147 GTTGGTGGTGCTGAGCCATGCGG - Intronic
1104756461 12:131272656-131272678 GATTCTGGTGAGGAGCCCTGAGG + Intergenic
1110392690 13:74993610-74993632 GTTAGTGGTGGTGAAGCCTCAGG + Intergenic
1113556477 13:111239645-111239667 GTTAATGATGAGGGGCCCTGAGG + Intronic
1114686115 14:24533433-24533455 CTTAGTTCTGGTGAGCCCTGGGG + Intergenic
1115176602 14:30569196-30569218 GTTAATGGTGGTTATCCCTGGGG - Intronic
1202838875 14_GL000009v2_random:101830-101852 ATTTGTTGTGATGAGTCCTGAGG + Intergenic
1202908239 14_GL000194v1_random:91894-91916 ATTTGTTGTGATGAGTCCTGGGG + Intergenic
1202884999 14_KI270722v1_random:97403-97425 ATTTGTTGTGATGAGTCCTGGGG - Intergenic
1127240564 15:57108986-57109008 GTTAGTGTGGATGAGTCCTTGGG + Intronic
1128080303 15:64853234-64853256 TTGAGTGGGGATGAGGCCTGGGG + Intronic
1130244498 15:82232204-82232226 GTTAGTAGTGATGCTCCCTGGGG + Intronic
1130397866 15:83520135-83520157 GTTAGAGGTGAGGAGCCCTGAGG + Intronic
1130537768 15:84799224-84799246 GATAGTAGTGAGGAGGCCTGAGG + Intronic
1136291120 16:29272030-29272052 GGTCCTGGAGATGAGCCCTGAGG + Intergenic
1138967201 16:62098866-62098888 GTTAGTGGGGATGGGGCATGAGG + Intergenic
1140055759 16:71524192-71524214 CTGAGTGGTGAAGAGACCTGGGG - Intronic
1142096984 16:88245491-88245513 GGTCCTGGAGATGAGCCCTGAGG + Intergenic
1143006386 17:3837830-3837852 GATAGTGTTCCTGAGCCCTGGGG - Intronic
1146637430 17:34516876-34516898 GTGCCTGGTGCTGAGCCCTGGGG - Intergenic
1152831579 17:82500625-82500647 GCTAGTGGTCAGGAGCCCCGTGG + Intergenic
1152844362 17:82590888-82590910 GCTCGTGGTGCTGAGCCCTCTGG - Intronic
1153075800 18:1160437-1160459 GCTGGTGGAGATGAGTCCTGAGG - Intergenic
1155536597 18:26825147-26825169 GTTAGTGATGAAGAGGGCTGAGG + Intergenic
1156409986 18:36818434-36818456 GTGCTTGGTGTTGAGCCCTGGGG - Intronic
1156900741 18:42297868-42297890 GTATTTGGTGATGAGACCTGGGG - Intergenic
1157053249 18:44195320-44195342 GTGATTGGTGTTGAGACCTGTGG - Intergenic
1160431932 18:78818833-78818855 GTTAGGTGAGATGAGCCCTCAGG + Intergenic
1160703882 19:520153-520175 GTTGGTGGTGGTGGGCACTGGGG - Intergenic
1161238496 19:3209297-3209319 GCCAGTGGTGATGGGCCCTTGGG - Exonic
1163130351 19:15268746-15268768 GGTAGAGGTAATGAGACCTGTGG - Intronic
1165324345 19:35105533-35105555 GGTAGTGGTGATGATGGCTGTGG - Intergenic
1165416395 19:35696491-35696513 GCCATTGGTGCTGAGCCCTGGGG - Intergenic
1165974065 19:39658756-39658778 GTTACGGGAGATGGGCCCTGAGG - Intronic
1166496500 19:43306623-43306645 GTGTGTGGTGTTGAGCCCTAAGG - Intergenic
1167491951 19:49798229-49798251 GTCAGTGGTGGAGAGCTCTGGGG + Intronic
1202634153 1_KI270706v1_random:28737-28759 ATTTGTTGTGATGAGTCCTGGGG - Intergenic
1202651722 1_KI270707v1_random:11266-11288 ATTTGTTGTGATGAGTCCTGGGG + Intergenic
932445397 2:71777855-71777877 GTTAATGGGTCTGAGCCCTGTGG - Intergenic
936151900 2:110026432-110026454 CTGAGTTGTGCTGAGCCCTGAGG + Intergenic
936151903 2:110026455-110026477 CTGAGTTGTGCTGAGCCCTGAGG + Intergenic
936151910 2:110026502-110026524 CTGAGTTGTGCTGAGCCCTGAGG + Intergenic
936151916 2:110026568-110026590 CTGAGTTGTGCTGAGCCCTGAGG + Intergenic
936151919 2:110026591-110026613 CTGAGTTGTGCTGAGCCCTGAGG + Intergenic
936151923 2:110026635-110026657 CTGAGTTGTGCTGAGCCCTGAGG + Intergenic
936151927 2:110026679-110026701 CTGAGTTGTGCTGAGCCCTGAGG + Intergenic
936192750 2:110344734-110344756 CTGAGTTGTGCTGAGCCCTGAGG - Intergenic
936192754 2:110344778-110344800 CTGAGTTGTGCTGAGCCCTGAGG - Intergenic
936192757 2:110344801-110344823 CTGAGTTGTGCTGAGCCCTGAGG - Intergenic
936192763 2:110344867-110344889 CTGAGTTGTGCTGAGCCCTGAGG - Intergenic
936192770 2:110344914-110344936 CTGAGTTGTGCTGAGCCCTGAGG - Intergenic
936192773 2:110344937-110344959 CTGAGTTGTGCTGAGCCCTGAGG - Intergenic
945946756 2:216002361-216002383 GTTAGTAGTGAGGAATCCTGAGG - Intronic
948696885 2:239737285-239737307 GGGAGGGGTGATGAGTCCTGGGG - Intergenic
1170698816 20:18684866-18684888 CTTAGTGGGGCTGAGCCCTCAGG - Intronic
1173132758 20:40410038-40410060 GTGAAGGATGATGAGCCCTGTGG - Intergenic
1173550835 20:43932185-43932207 GTGAGTGGTGATGACCCTTTTGG - Intronic
1176600424 21:8788376-8788398 ATTTGTTGTGATGAGTCCTGGGG - Intergenic
1176627598 21:9106572-9106594 ATTTGTTGTGATGAGTCCTGGGG + Intergenic
1176646371 21:9354517-9354539 ATTTGTTGTGATGAGTCCTGGGG - Intergenic
1179382324 21:40911026-40911048 GTGAGTGGACATGAGCCATGGGG + Intergenic
1180327888 22:11448020-11448042 ATTTGTTGTGATGAGTCCTGGGG - Intergenic
1180366546 22:11944492-11944514 ATTTGTTGTGATGAGTCCTGGGG + Intergenic
1182574986 22:31266944-31266966 GTTAATGGTGCTGAGACCAGAGG - Intronic
1183632689 22:39042864-39042886 TTTAGTGGACATCAGCCCTGAGG + Intronic
1183720752 22:39560117-39560139 GTTGGAGGTGGTGACCCCTGTGG - Intergenic
949136245 3:569997-570019 GTAAGAGGTCATGTGCCCTGAGG + Intergenic
951762490 3:26161885-26161907 GTGAGTGGTGATTAGCCTGGTGG + Intergenic
956583847 3:70843126-70843148 GGCAGTGGTGATGAGTCTTGGGG + Intergenic
956908100 3:73788120-73788142 GTAAGTGATGATAAGCCCTATGG + Intergenic
958667916 3:97163597-97163619 GATAGTGGTGATGGGTCCTGAGG + Intronic
961543901 3:127618821-127618843 CCTTGTGGAGATGAGCCCTGTGG + Intronic
961916733 3:130383412-130383434 GGTAGTGGTGATTAGCAATGAGG - Intronic
963685733 3:148431527-148431549 GTGAGCAGTGATGACCCCTGTGG - Intergenic
964390200 3:156188926-156188948 GTGAGTCGTGGTGGGCCCTGGGG + Intronic
967545367 3:190720176-190720198 GTTAGTGATGTTGGCCCCTGTGG - Intergenic
967969969 3:194991493-194991515 GTGAGTGGTGATGCTCCCTCGGG + Intergenic
1202740511 3_GL000221v1_random:50524-50546 ATTTGTTGTGATGAGTCCTGGGG + Intergenic
973363853 4:49191122-49191144 ATTTGTTGTGATGAGACCTGGGG - Intergenic
973397227 4:49605616-49605638 ATTTGTTGTGATGAGACCTGGGG + Intergenic
979210920 4:118101128-118101150 GTTAGTGTTGATGACACGTGTGG - Intronic
982136975 4:152281386-152281408 GGATGTGGTGGTGAGCCCTGTGG - Intergenic
1202761165 4_GL000008v2_random:112218-112240 ATTTGTTGTGATGAGACCTGGGG - Intergenic
988043356 5:25916040-25916062 GTTAGTGATGTTGAGCCTTTTGG - Intergenic
999082637 5:148858729-148858751 GTTTGTGGTGGGAAGCCCTGGGG - Intergenic
999729573 5:154466623-154466645 GCTAGTGGCTATGAGCCCTCAGG - Intergenic
1001560678 5:172666942-172666964 GTTGGAGGAGATGATCCCTGAGG + Intronic
1004395458 6:15244020-15244042 ATTAGTGGTGATCAAACCTGTGG - Intergenic
1006514041 6:34536281-34536303 TTTAGTGATGGGGAGCCCTGAGG + Intergenic
1008892491 6:56511313-56511335 GTTACTGGAATTGAGCCCTGGGG - Exonic
1013802984 6:113968922-113968944 GTTGGTAGTGATGGGCTCTGAGG - Intronic
1018740233 6:166722911-166722933 GCGAGTTGTGATGAGTCCTGTGG - Intronic
1018789460 6:167135517-167135539 GTCAGTGATGATCACCCCTGTGG - Intronic
1021860141 7:24897769-24897791 GCTAGTGGTGATGAATTCTGTGG - Intronic
1024187002 7:46959656-46959678 GCCAGTGGTGATGAGGCCTTTGG + Intergenic
1025242929 7:57293103-57293125 GTTAATGGTGCTGAGACCAGAGG - Intergenic
1026945722 7:74314798-74314820 GATAGTGGGGAAGAGGCCTGGGG + Intronic
1028788055 7:94819437-94819459 GTCAGTGGTGCTAAGCCATGCGG - Intergenic
1032785147 7:135194671-135194693 GTTTGTGGTGGTCCGCCCTGGGG - Intronic
1034225458 7:149477617-149477639 GATATTGGGGAGGAGCCCTGGGG - Exonic
1035405597 7:158595127-158595149 GTTAGTGGTGATGAAGCTAGTGG + Intergenic
1035561870 8:610785-610807 GTTGGTGGTGCAGAGCCCAGTGG + Intergenic
1035564981 8:635394-635416 GTTAGTGGTGATGAGCCCTGCGG - Intronic
1035608401 8:944657-944679 GTGGGTGGTAATGATCCCTGCGG + Intergenic
1035608435 8:944816-944838 GTGGGTGGTAATGATCCCTGCGG + Intergenic
1036548986 8:9800217-9800239 GTTGGTGGTGCTGAGCCACGCGG + Intergenic
1037985111 8:23285750-23285772 TTTAGTGGGGATGGGCGCTGTGG - Intronic
1038641695 8:29334077-29334099 GTGTGTGTTGAGGAGCCCTGGGG - Exonic
1040886296 8:52267158-52267180 GACAGTGGGGATGAACCCTGAGG + Intronic
1047007162 8:120632375-120632397 TTTAGTGGTTATGAGCGCTGGGG + Intronic
1049997148 9:1044602-1044624 GTTAGTCGTGAGGACCCCTAGGG + Intergenic
1057187406 9:93064656-93064678 GTGTGTTGTGCTGAGCCCTGTGG - Intronic
1059391686 9:114003152-114003174 CTTATTGGTGATTTGCCCTGAGG + Intronic
1059824281 9:118009673-118009695 GCTAGTGGTCATGAGCTCTCTGG - Intergenic
1060239494 9:121890580-121890602 ATGAGTGGTGATGAGCGCTATGG - Intronic
1061883626 9:133580007-133580029 GGAAGTGGGGAAGAGCCCTGTGG - Intronic
1062167598 9:135115688-135115710 GCCAGTGGTGATCTGCCCTGGGG - Intronic
1062412021 9:136430445-136430467 GTTACTTGTGAGGAGCCGTGGGG + Intronic
1203750444 Un_GL000218v1:74252-74274 ATTTGTTGTGATGAGTCCTGGGG + Intergenic
1203483551 Un_GL000224v1:30094-30116 ATTTGTTGTGATGAGTCCTGGGG - Intergenic
1203709155 Un_KI270742v1:80473-80495 ATTTGTTGTGATGAGTCCTGGGG + Intergenic
1203541934 Un_KI270743v1:97099-97121 ATTTGTTGTGATGAGACCTGGGG - Intergenic
1191162743 X:57348739-57348761 GTTGGTTGTGTTGAGCCCTTTGG - Intronic
1199845823 X:151692615-151692637 ATTGGTGGTGATGAGACATGAGG + Intergenic
1201164099 Y:11191915-11191937 ATTTGTTGTGATGAGTCCTGGGG + Intergenic