ID: 1035564982

View in Genome Browser
Species Human (GRCh38)
Location 8:635409-635431
Sequence TTAGCTGTCACTATTGTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035564982_1035564987 -5 Left 1035564982 8:635409-635431 CCACTAACAATAGTGACAGCTAA No data
Right 1035564987 8:635427-635449 GCTAAGGCTGGCTGTGAGAGGGG No data
1035564982_1035564989 5 Left 1035564982 8:635409-635431 CCACTAACAATAGTGACAGCTAA No data
Right 1035564989 8:635437-635459 GCTGTGAGAGGGGCTGTCTAGGG No data
1035564982_1035564988 4 Left 1035564982 8:635409-635431 CCACTAACAATAGTGACAGCTAA No data
Right 1035564988 8:635436-635458 GGCTGTGAGAGGGGCTGTCTAGG No data
1035564982_1035564985 -7 Left 1035564982 8:635409-635431 CCACTAACAATAGTGACAGCTAA No data
Right 1035564985 8:635425-635447 CAGCTAAGGCTGGCTGTGAGAGG No data
1035564982_1035564986 -6 Left 1035564982 8:635409-635431 CCACTAACAATAGTGACAGCTAA No data
Right 1035564986 8:635426-635448 AGCTAAGGCTGGCTGTGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035564982 Original CRISPR TTAGCTGTCACTATTGTTAG TGG (reversed) Intronic