ID: 1035564982

View in Genome Browser
Species Human (GRCh38)
Location 8:635409-635431
Sequence TTAGCTGTCACTATTGTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 159}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035564982_1035564987 -5 Left 1035564982 8:635409-635431 CCACTAACAATAGTGACAGCTAA 0: 1
1: 0
2: 0
3: 13
4: 159
Right 1035564987 8:635427-635449 GCTAAGGCTGGCTGTGAGAGGGG No data
1035564982_1035564985 -7 Left 1035564982 8:635409-635431 CCACTAACAATAGTGACAGCTAA 0: 1
1: 0
2: 0
3: 13
4: 159
Right 1035564985 8:635425-635447 CAGCTAAGGCTGGCTGTGAGAGG No data
1035564982_1035564989 5 Left 1035564982 8:635409-635431 CCACTAACAATAGTGACAGCTAA 0: 1
1: 0
2: 0
3: 13
4: 159
Right 1035564989 8:635437-635459 GCTGTGAGAGGGGCTGTCTAGGG No data
1035564982_1035564986 -6 Left 1035564982 8:635409-635431 CCACTAACAATAGTGACAGCTAA 0: 1
1: 0
2: 0
3: 13
4: 159
Right 1035564986 8:635426-635448 AGCTAAGGCTGGCTGTGAGAGGG No data
1035564982_1035564988 4 Left 1035564982 8:635409-635431 CCACTAACAATAGTGACAGCTAA 0: 1
1: 0
2: 0
3: 13
4: 159
Right 1035564988 8:635436-635458 GGCTGTGAGAGGGGCTGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035564982 Original CRISPR TTAGCTGTCACTATTGTTAG TGG (reversed) Intronic
902229899 1:15021392-15021414 TTCCCTGCCACTATTTTTAGTGG + Intronic
902745785 1:18473470-18473492 ATAGCTGTCACGGTTATTAGGGG - Intergenic
903522549 1:23962129-23962151 TCAGCTTTTTCTATTGTTAGGGG + Exonic
905036944 1:34924818-34924840 TTAGGTTTCACAGTTGTTAGTGG - Intronic
907078391 1:51598549-51598571 TTAGTTGTCACAACTGTCAGGGG - Intronic
910045897 1:82915636-82915658 TGAGATGTCACTATTGTGACAGG - Intergenic
911692998 1:100856687-100856709 TTTTCTGTCACTATTGTAACTGG + Intergenic
911797056 1:102088879-102088901 TTAGCAGTCACTTTTGTAAAGGG + Intergenic
913342912 1:117777811-117777833 TCAGCTTTTTCTATTGTTAGGGG - Intergenic
918745725 1:188196279-188196301 TTAACTGATACTATTTTTAGAGG + Intergenic
1065686995 10:28295690-28295712 TTTGCTGTGAATATTGTCAGAGG - Intronic
1067398455 10:45947229-45947251 TTAGTTATCACAATTGTTGGTGG + Intergenic
1067866767 10:49916312-49916334 TTAGTTATCACAATTGTTGGTGG + Intronic
1069092587 10:64219564-64219586 TTAGCTGCCAATATTGGAAGAGG - Intergenic
1071996102 10:91151048-91151070 TTAACTGTCAGTCTTTTTAGTGG + Intergenic
1072275187 10:93815926-93815948 TCAGCCGTCACTATGGTTACAGG - Intergenic
1078945592 11:16065257-16065279 TTATTTGTGACTATTGTAAGTGG - Intronic
1079908044 11:26273476-26273498 TGAGCTGTCATTGTTGTTACAGG + Intergenic
1081341946 11:41938766-41938788 ATTGCTGTCACTATTATTACAGG - Intergenic
1082950115 11:58805593-58805615 TTATCTGTCAGGGTTGTTAGGGG - Intergenic
1083512360 11:63222371-63222393 TTATTTGTCACTATTGTAAATGG + Intronic
1086067409 11:82760989-82761011 TAATTTGTCACTATTGTTAGAGG - Intergenic
1086123412 11:83325763-83325785 TTAGCTGTAAATAGTGTCAGTGG + Intergenic
1086501999 11:87463361-87463383 TTCGCTGTCACTTTTGTTGTTGG - Intergenic
1087156804 11:94912936-94912958 CTAGCTGTAACTATTTTTAAAGG - Intergenic
1087507953 11:99051941-99051963 TTAGCTCTGACTATTCTTAAAGG + Intronic
1088892887 11:114058901-114058923 TTAGCTGTCGCGATTGCTGGAGG - Intergenic
1091605708 12:1949691-1949713 TGAGCTGCCACCCTTGTTAGGGG + Intronic
1092599922 12:10049359-10049381 CAAGCTGACTCTATTGTTAGGGG - Intronic
1094081247 12:26538272-26538294 TAAGCTGTTACTATTATTTGGGG + Intronic
1094294937 12:28894998-28895020 GTTGCTGTTACTATTGTTATTGG - Intergenic
1098574820 12:72029101-72029123 TTAGCAGTCACTATGTATAGAGG - Intronic
1099898465 12:88678530-88678552 GTTGCTGTTGCTATTGTTAGAGG + Intergenic
1099939500 12:89168666-89168688 GTTGCTGTCCCTGTTGTTAGAGG - Intergenic
1101110021 12:101477412-101477434 TTGGCTGTCTCTGTTGTCAGGGG - Intronic
1102289169 12:111685293-111685315 TTAGTTATGACTATGGTTAGGGG + Intronic
1105270833 13:18874587-18874609 TTTGCTGTTATTGTTGTTAGAGG + Intergenic
1106191359 13:27456015-27456037 TAAGCTGTCACTATCAATAGGGG - Intergenic
1108483172 13:50896018-50896040 TTAGCTGTTATTACTGTTATTGG + Intergenic
1112059829 13:95727465-95727487 TTAGCTCTTACTATTGTTATAGG + Intronic
1112267902 13:97942245-97942267 ATAGCTGTCACTCTTGCTGGGGG - Intergenic
1114182021 14:20375647-20375669 TTAGCTATCACTATTATTAATGG + Intronic
1118019174 14:61693738-61693760 TTAGCTCTTAGTATTGTTGGTGG - Intergenic
1120512795 14:85435835-85435857 ATAGCTATAACTATTGTTTGTGG + Intergenic
1121689955 14:95870825-95870847 ATAGTTGTCACTATTGTAACAGG + Intergenic
1124839075 15:33225123-33225145 TTAGCAGTCATTTTTCTTAGTGG + Intergenic
1127569125 15:60223741-60223763 TTAGCTATTACTATTAGTAGTGG - Intergenic
1128556148 15:68633111-68633133 TTAGCTGTCACCATTGAGTGTGG + Intronic
1129987587 15:79932213-79932235 ATAGCTGTTACTATTATTACTGG - Intergenic
1130240537 15:82184080-82184102 CTAGCTGTCACTATAATCAGTGG + Intronic
1130821645 15:87502320-87502342 TTAGCTGTTACTAATTTTAATGG - Intergenic
1131154443 15:90066270-90066292 TTAACTGTCATTATTGGTAATGG - Intronic
1134862426 16:17572446-17572468 TTAGCTGTTCCTATTGCAAGGGG + Intergenic
1135205784 16:20482798-20482820 TTATCTGTCTCTATTGTTATTGG + Intronic
1135247763 16:20871785-20871807 TTTGCTGTCACTATTGATCTGGG + Intronic
1137389550 16:48069887-48069909 TTAGCTGTGCCTATTGTGAGTGG - Intergenic
1138444182 16:57053079-57053101 TCAGCTCCCACTATTGTAAGAGG - Intronic
1138463429 16:57168169-57168191 CTAGATGTCACTATTGTTCCAGG - Intronic
1138575955 16:57907460-57907482 CTAGCTATGGCTATTGTTAGGGG - Intronic
1146422088 17:32696865-32696887 TTAACTGTCACTAAAGCTAGTGG - Intronic
1149089669 17:52762971-52762993 TCAGCTATCACCATTGTTTGAGG + Intergenic
1150141216 17:62730529-62730551 TTAGTTGTCACTGTTCTTTGAGG + Intronic
1151881015 17:76894454-76894476 GTAACTGTCATTATCGTTAGTGG + Intronic
1152837152 17:82540791-82540813 TCAGCTGTCAACCTTGTTAGTGG - Intronic
1154132046 18:11745801-11745823 GTAGCTTTCACTATTGTAACAGG - Intronic
1155651716 18:28151298-28151320 TTAGCTGTCACAACTGCGAGGGG + Intronic
1156119263 18:33822045-33822067 TTTGCTTTGACTATTGGTAGGGG - Intergenic
1156245398 18:35293019-35293041 TTAGCAGTGACTATTTCTAGAGG - Intergenic
1157421589 18:47551806-47551828 TTAGCTGTTATTGTTGTTAAGGG + Intergenic
1157879745 18:51309676-51309698 TTATCTGTGGCTATTGTAAGTGG - Intergenic
1158589816 18:58769760-58769782 TTAGCTGTTATAATTATTAGGGG - Intergenic
1167849630 19:52191431-52191453 TTAGCTGTAATTATTGGGAGTGG + Intronic
926643365 2:15262026-15262048 TTACCTGTCACTCTGGTGAGAGG - Intronic
928202794 2:29261311-29261333 TTTGCTGTCAATATTGTTCATGG + Intronic
928426070 2:31178889-31178911 TTATCTTTGATTATTGTTAGTGG + Intronic
929086410 2:38171855-38171877 TTAGCTGTCCCTATTTTCAGAGG - Intergenic
929814796 2:45222053-45222075 TTAGCTGTCACTCTTGTGTTGGG - Intergenic
930685546 2:54303396-54303418 TTAGCTTTCATTATTATTTGTGG + Intronic
933136651 2:78743854-78743876 TTAGCTGTCTATATTCTAAGTGG - Intergenic
936939386 2:117868283-117868305 TTATATGTAACTATTGTAAGTGG + Intergenic
943532036 2:189094963-189094985 TTAACTGTCACAATTGTATGGGG + Intronic
944213358 2:197229584-197229606 TTATCTGTCAATATTGCTAAAGG - Intronic
946998386 2:225422633-225422655 TTAGCTGACACTGTTGGTAATGG - Intronic
947234666 2:227927729-227927751 ATAGCTGACTCTATTGCTAGGGG + Intergenic
1168805126 20:668153-668175 TGAGCTGTTATTATTGTTACTGG + Intronic
1169741600 20:8900931-8900953 ATAGCTGTTATTTTTGTTAGAGG + Intronic
1170244700 20:14207686-14207708 TTCGCTGTCACTGTTGATAGGGG - Intronic
1171891248 20:30718708-30718730 TTTGCTGTTATTGTTGTTAGAGG + Intergenic
1175547858 20:59790792-59790814 TTAGCAGTCGCTTTTTTTAGAGG + Intronic
1177105585 21:16951284-16951306 TTATCTGTAGCTATTGTTAATGG - Intergenic
1178192913 21:30306791-30306813 TTAGCTGACAATAAGGTTAGCGG + Intergenic
1178211899 21:30544473-30544495 TTACATGTCACTATTGTAAAAGG + Intronic
951317172 3:21202653-21202675 TTAGCTGTAAATAGTGTCAGTGG + Intergenic
953782181 3:45880932-45880954 TTTGCTGTCACTGTTCTAAGAGG - Intronic
954990316 3:54835266-54835288 TTAGCTGTCATGATTATTGGTGG + Intronic
955651006 3:61193809-61193831 TTGGCTGTGACTCTTGTGAGAGG - Intronic
955743052 3:62112587-62112609 TTAACTGTTACTATTATTTGAGG + Intronic
956500463 3:69878018-69878040 TTTGCTGTCACTATTATTATAGG - Intronic
960061058 3:113321757-113321779 TTTATTGTCACTATTGTAAGTGG - Intronic
960599490 3:119441818-119441840 TAAGCTGACTCTCTTGTTAGTGG + Intronic
963538421 3:146557069-146557091 ATAGCTCACACTATTGTTTGTGG - Intergenic
966184033 3:177212472-177212494 CTAGCTCTCACTATTGTTTGAGG - Intergenic
966337900 3:178890889-178890911 TTATTTGTAACTATTGTAAGTGG - Intergenic
967544938 3:190714582-190714604 TAAGCTGACTCTCTTGTTAGGGG - Intergenic
972161181 4:36229573-36229595 TTTTCTGTCACAATTGATAGAGG - Exonic
973201271 4:47505232-47505254 TTAGCTATCACTCATGTTATTGG - Intronic
974874218 4:67683594-67683616 TCAGCTATCATTACTGTTAGTGG + Intronic
974912000 4:68133495-68133517 TTGGCTGTAAATATTGTCAGTGG - Intergenic
976076050 4:81300092-81300114 TTATCTGTCCCTATTCTTTGGGG + Intergenic
977085167 4:92587398-92587420 TTTGCTGTGACTATTGGAAGTGG + Intronic
979542333 4:121899331-121899353 TTTGCTTTCAATATTGTGAGAGG + Intronic
981152580 4:141396269-141396291 TTAGTTAGCACTATTGTTTGAGG + Intergenic
981403681 4:144342340-144342362 TTAGCAGTACCTATTGTCAGCGG - Intergenic
985118990 4:186620572-186620594 TTAGCTGTCATTACTGCTATTGG - Exonic
985389112 4:189476497-189476519 TTAGCTGTCTCTAATGTTAAAGG + Intergenic
986682093 5:10243100-10243122 TAAGCTGACTCTCTTGTTAGGGG - Intronic
987631839 5:20483159-20483181 TTATTTGTAACTATTGTTAATGG - Intronic
989207991 5:38830745-38830767 TTAGCTCTCACTATTTTTCTTGG + Intergenic
990078888 5:51887427-51887449 TGATTTGTAACTATTGTTAGCGG - Intergenic
990333802 5:54752879-54752901 TTAGCTGTAAATATTGTGTGGGG - Intergenic
990577880 5:57140751-57140773 TTATCTGTAACTATTGTAAATGG + Intergenic
990866807 5:60388875-60388897 TTAGCTGTCGTTATTGATAATGG - Intronic
993089572 5:83408693-83408715 TTCCCTGTCACTATTGTCTGAGG + Intergenic
993160290 5:84281537-84281559 TTAGCTGTTAATATGGTTTGTGG + Intronic
994665850 5:102704566-102704588 TTTGCTGTCACTATGTTGAGTGG - Intergenic
994944574 5:106369691-106369713 TTATTTGTCACTATTGTAAATGG - Intergenic
995383089 5:111557135-111557157 TTAGCTCTAACAATTGTTTGTGG + Intergenic
997497966 5:134346460-134346482 TTGGCTGTGACTCTTGTTACAGG + Intronic
1000212972 5:159126092-159126114 TTAGCTATCATTAGTGTTATTGG - Intergenic
1000661228 5:163941114-163941136 TAAGCTGACTCTCTTGTTAGGGG + Intergenic
1003843388 6:10146587-10146609 TTAGATTTCAGTATTGTTATGGG - Intronic
1008351083 6:50491170-50491192 TTAGCAGTGGCCATTGTTAGAGG - Intergenic
1008351848 6:50500242-50500264 TCAGCTGTCAATAGTGTCAGTGG - Intergenic
1011229387 6:85143026-85143048 TTAGCTGTGACTTTGGTTAATGG - Intergenic
1011305477 6:85921279-85921301 CTAGCTCTCACAATTGCTAGGGG + Intergenic
1013711328 6:112903200-112903222 TCAACTGTCAATATTGTTATTGG + Intergenic
1014931235 6:127339145-127339167 TAGGCTGTAATTATTGTTAGTGG - Intronic
1015281014 6:131434019-131434041 TTAGCAGTCAGCATTGTCAGAGG - Intergenic
1021282839 7:18741270-18741292 TAAGCTGACTCTCTTGTTAGAGG + Intronic
1026626754 7:72000275-72000297 TTTTCTGTCACTGTTGCTAGAGG - Intronic
1027900258 7:84104404-84104426 CTATCTGTCACTGTTTTTAGGGG + Intronic
1027973972 7:85125070-85125092 TTACCTTTCACTTTTTTTAGAGG - Intronic
1028866854 7:95723394-95723416 CTAGCTATCAGTATTGTTAATGG - Intergenic
1035564982 8:635409-635431 TTAGCTGTCACTATTGTTAGTGG - Intronic
1040701667 8:50074032-50074054 CTAACTGACTCTATTGTTAGGGG - Intronic
1041053922 8:53963214-53963236 TTAGCTGTCACTGTTCATATGGG + Intergenic
1042235565 8:66609849-66609871 TTAACTGGCAATATTGTTTGGGG - Intronic
1043216003 8:77589125-77589147 TTGGCCGTCAGTATTTTTAGTGG - Intergenic
1043263136 8:78227051-78227073 TTGGCTGTTACTATGGTTACTGG - Intergenic
1044100647 8:88132831-88132853 GTAGCATTCACTATTGTTACTGG - Intronic
1046087794 8:109460608-109460630 TTGGTTGTCACAGTTGTTAGAGG - Intronic
1046715965 8:117567526-117567548 TTAGCTGTCAGTCTTTTCAGTGG + Intergenic
1047663987 8:127069686-127069708 TAAGCTGACTCTCTTGTTAGGGG + Intergenic
1050638493 9:7639740-7639762 TTTTCTGTCACCATAGTTAGGGG + Intergenic
1050793482 9:9505515-9505537 GTAGCTGTCATTATTATTTGAGG + Intronic
1051202619 9:14645045-14645067 TTAGCTATCACTATGGTTTGTGG + Intronic
1051844760 9:21438996-21439018 TTAGCTAACACTATAGTCAGTGG - Intronic
1053155554 9:35776129-35776151 TTAGCTGTCACTGGTGGGAGAGG + Intergenic
1054357592 9:64077104-64077126 TTTGCTGTTATTGTTGTTAGAGG - Intergenic
1055283619 9:74703665-74703687 TTATTTGTAGCTATTGTTAGTGG - Intergenic
1056274346 9:84978762-84978784 TCAGCTGACTCTCTTGTTAGGGG + Intronic
1059988868 9:119845710-119845732 TAAGTAGTCACTATTATTAGTGG + Intergenic
1186345082 X:8683848-8683870 TTAGCTGTCACTCTGCTGAGAGG - Intronic
1189108584 X:38263001-38263023 TTCTCTGTCACAATTGTTAGAGG + Intronic
1192079517 X:68033280-68033302 GTAGCACTCACTAATGTTAGTGG - Intergenic
1192457163 X:71286025-71286047 TTAACAGTGACTATTTTTAGTGG + Intronic
1192860628 X:75065932-75065954 TTAGGTGTTGCTATTCTTAGGGG + Intronic
1196574908 X:117305724-117305746 TAAACTGGCACTAGTGTTAGTGG - Intergenic
1198199115 X:134397689-134397711 TTAACTGTCACCATTGATAGGGG - Intronic
1198395754 X:136217728-136217750 TTAGCTGTCAAAATTGTCACTGG + Exonic
1198464515 X:136892884-136892906 TTAGCTATCAATAATGATAGTGG + Intergenic
1198835833 X:140804085-140804107 TTAGCAGTCCCCATTGTGAGTGG + Intergenic
1202042441 Y:20699335-20699357 TATGCTGGCACTAATGTTAGTGG + Intergenic