ID: 1035564985

View in Genome Browser
Species Human (GRCh38)
Location 8:635425-635447
Sequence CAGCTAAGGCTGGCTGTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035564976_1035564985 21 Left 1035564976 8:635381-635403 CCCTCCAAAGTCCCCGCAGGGCT 0: 1
1: 0
2: 0
3: 17
4: 142
Right 1035564985 8:635425-635447 CAGCTAAGGCTGGCTGTGAGAGG No data
1035564981_1035564985 8 Left 1035564981 8:635394-635416 CCGCAGGGCTCATCACCACTAAC 0: 1
1: 0
2: 1
3: 9
4: 148
Right 1035564985 8:635425-635447 CAGCTAAGGCTGGCTGTGAGAGG No data
1035564977_1035564985 20 Left 1035564977 8:635382-635404 CCTCCAAAGTCCCCGCAGGGCTC 0: 1
1: 0
2: 0
3: 23
4: 191
Right 1035564985 8:635425-635447 CAGCTAAGGCTGGCTGTGAGAGG No data
1035564980_1035564985 9 Left 1035564980 8:635393-635415 CCCGCAGGGCTCATCACCACTAA 0: 1
1: 0
2: 0
3: 5
4: 141
Right 1035564985 8:635425-635447 CAGCTAAGGCTGGCTGTGAGAGG No data
1035564979_1035564985 10 Left 1035564979 8:635392-635414 CCCCGCAGGGCTCATCACCACTA 0: 1
1: 0
2: 1
3: 7
4: 71
Right 1035564985 8:635425-635447 CAGCTAAGGCTGGCTGTGAGAGG No data
1035564978_1035564985 17 Left 1035564978 8:635385-635407 CCAAAGTCCCCGCAGGGCTCATC 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1035564985 8:635425-635447 CAGCTAAGGCTGGCTGTGAGAGG No data
1035564982_1035564985 -7 Left 1035564982 8:635409-635431 CCACTAACAATAGTGACAGCTAA 0: 1
1: 0
2: 0
3: 13
4: 159
Right 1035564985 8:635425-635447 CAGCTAAGGCTGGCTGTGAGAGG No data
1035564973_1035564985 30 Left 1035564973 8:635372-635394 CCTGAGCTTCCCTCCAAAGTCCC 0: 1
1: 1
2: 2
3: 20
4: 245
Right 1035564985 8:635425-635447 CAGCTAAGGCTGGCTGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035564985 Original CRISPR CAGCTAAGGCTGGCTGTGAG AGG Intronic
No off target data available for this crispr