ID: 1035573150

View in Genome Browser
Species Human (GRCh38)
Location 8:687586-687608
Sequence GAGCAGGACTGGAGGGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035573141_1035573150 2 Left 1035573141 8:687561-687583 CCGTGGAGGGAGGCAGCGGCGCA 0: 1
1: 0
2: 0
3: 17
4: 233
Right 1035573150 8:687586-687608 GAGCAGGACTGGAGGGAGGCGGG No data
1035573140_1035573150 3 Left 1035573140 8:687560-687582 CCCGTGGAGGGAGGCAGCGGCGC 0: 1
1: 0
2: 2
3: 19
4: 207
Right 1035573150 8:687586-687608 GAGCAGGACTGGAGGGAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035573150 Original CRISPR GAGCAGGACTGGAGGGAGGC GGG Intronic
No off target data available for this crispr