ID: 1035574657

View in Genome Browser
Species Human (GRCh38)
Location 8:696898-696920
Sequence GCTGATGGGGAGGAAGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1561
Summary {0: 4, 1: 2, 2: 13, 3: 187, 4: 1355}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035574657 Original CRISPR GCTGATGGGGAGGAAGGAGA GGG (reversed) Intronic
900000659 1:13140-13162 CCTGAGGCTGAGGAAGGAGAAGG + Intergenic
900020376 1:183659-183681 CCTGAGGCTGAGGAAGGAGAAGG + Intergenic
900204846 1:1427439-1427461 GGTGATGGAGGGGAAGGGGAGGG - Intronic
900300232 1:1973426-1973448 GCTGAAGGGAAGGAATGAGATGG + Intronic
900313982 1:2048101-2048123 CCTGATGGGCAGGAAAGAGCAGG - Intergenic
900326787 1:2112130-2112152 GCAGAGGTGAAGGAAGGAGAGGG - Intronic
900338788 1:2177948-2177970 GCTGATGGGTGGCAAGGAAACGG - Intronic
900700781 1:4047483-4047505 GAGGAAGGGGAGGAAGGAGGAGG + Intergenic
900716055 1:4144840-4144862 GATGATGGTGATGATGGAGATGG - Intergenic
900791517 1:4683995-4684017 AAGAATGGGGAGGAAGGAGATGG + Intronic
900932846 1:5747670-5747692 GAGGAGAGGGAGGAAGGAGAGGG + Intergenic
900940902 1:5798092-5798114 GCTGATGGGGAGAGAGGAGGTGG + Intergenic
901193153 1:7424643-7424665 ACTGAGAGGAAGGAAGGAGAGGG - Intronic
901300454 1:8196572-8196594 GCTGAGGGAGAGGGAGAAGAGGG - Intergenic
901326920 1:8372269-8372291 GCTGACATGGAGGCAGGAGAAGG + Intronic
901691862 1:10978869-10978891 GCTGGTGGGCAAAAAGGAGAGGG + Intronic
901710532 1:11111141-11111163 TCTGATGGGTAGAAAGGAAAAGG - Intronic
901741704 1:11346006-11346028 CCTGTTAGGGAGGGAGGAGATGG - Intergenic
901778946 1:11579911-11579933 GCTGGTGGTGATGAAGGAGATGG + Intergenic
902038283 1:13473462-13473484 GCTGAAGGGGAGAAAAGAGTGGG + Intergenic
902108849 1:14060971-14060993 GCTGCTGGTGTGGGAGGAGAAGG - Intergenic
902388167 1:16088002-16088024 GCTGGCTGGCAGGAAGGAGAAGG - Intergenic
902706514 1:18209019-18209041 GTGACTGGGGAGGAAGGAGAAGG + Intronic
902983049 1:20139256-20139278 GCTGTGGGGGAGGGAGGAGGAGG + Intergenic
903050200 1:20594917-20594939 GGTGATGGGCAGGGAAGAGAAGG + Intronic
903083331 1:20831468-20831490 GCTTATGGGCAGGAGGGAGCTGG - Intronic
903149721 1:21398215-21398237 AGTGATGAGGAGGAAGAAGAGGG + Intergenic
903344421 1:22675348-22675370 GGAGATGGGCAGGCAGGAGAAGG - Intergenic
903476929 1:23626003-23626025 GATGATGGGGATGATGGTGATGG + Intronic
903476966 1:23626219-23626241 GGTGATGGGGATGATGGTGATGG + Intronic
903476985 1:23626297-23626319 GGTGATGGGGATGATGGTGATGG + Intronic
903476992 1:23626327-23626349 GATGATGGGGATGATGGTGATGG + Intronic
904306347 1:29592662-29592684 GGTGCTGGGGTGGAAGGTGAGGG + Intergenic
904323683 1:29713098-29713120 GCAGATGGGGAGGAAGGCCTGGG + Intergenic
904417472 1:30372180-30372202 GGTGGTTGGGAGGAAGAAGATGG - Intergenic
904500421 1:30909573-30909595 GCCGCTGGGGATGAAGGTGAAGG - Intergenic
904567608 1:31437045-31437067 GATGAGGGTGAGGGAGGAGAAGG - Intergenic
904573041 1:31482058-31482080 GCTGAGGAGGAGGAGGAAGAGGG - Intergenic
904592665 1:31623707-31623729 GCTGATGGGCAGGTAGCAGAGGG - Exonic
904630168 1:31835193-31835215 GCTGAAGAGGAGGAAGAGGAGGG + Intergenic
904637826 1:31898017-31898039 ACTGCTGTGGAGGAATGAGAAGG - Intergenic
904686816 1:32266682-32266704 GGGGATGGGGAGGAGGGGGAAGG - Intronic
904715245 1:32463128-32463150 GAGGAAGGAGAGGAAGGAGAAGG - Intergenic
904767267 1:32860111-32860133 ACAGGTGGGGAGGAAGGACAAGG - Intergenic
904849398 1:33446081-33446103 GCTGCAGGGGAGGATGGGGAAGG + Intergenic
904901713 1:33862757-33862779 GCTCACAGGGAGGAAGGGGATGG + Intronic
904939837 1:34157851-34157873 GCAGATGAGAGGGAAGGAGATGG - Intronic
905359712 1:37410964-37410986 GCTGGTGTGGAGGATGGAGGCGG - Intergenic
905461588 1:38126100-38126122 GCCGGTGCGGAGGCAGGAGATGG + Intergenic
905462910 1:38133233-38133255 GGGGATGGGGAAGAAGGGGAGGG + Intergenic
905530200 1:38672172-38672194 GCCGAGGGAGAGGAAGAAGAAGG + Intergenic
905532660 1:38694495-38694517 TCTGTTGGGGAGGATGGAGTGGG - Intergenic
905806828 1:40883543-40883565 GGGCATGGGGAGGAAAGAGATGG - Intergenic
906103571 1:43278405-43278427 GGGAATGAGGAGGAAGGAGATGG + Intergenic
906865056 1:49409112-49409134 TTTGATGGAGAGGAAGGAGAGGG - Intronic
907207293 1:52784386-52784408 GCTGATAGTGAGGAATGGGAAGG + Intronic
907266541 1:53265027-53265049 GTGGATGGGTTGGAAGGAGAGGG + Intronic
907276124 1:53317428-53317450 GCAGATGGGGTGGGATGAGATGG + Intronic
907279276 1:53334970-53334992 GCTGGCGGGGAGGAAGGAAGGGG - Intergenic
907292429 1:53425314-53425336 GCTGCTAAGGATGAAGGAGAAGG - Intergenic
907303553 1:53502263-53502285 GGGGATGGGGAGAGAGGAGAAGG + Intergenic
907303565 1:53502302-53502324 GAGGAGAGGGAGGAAGGAGAGGG + Intergenic
907303576 1:53502343-53502365 GGGGATGGGGAGAGAGGAGAAGG + Intergenic
907303604 1:53502423-53502445 GGGGATGGGGAGAGAGGAGAAGG + Intergenic
907303632 1:53502503-53502525 GGGGATGGGGAGAGAGGAGAAGG + Intergenic
907307364 1:53520763-53520785 GCAGCTGGGGAGCAAGCAGAGGG + Exonic
907517650 1:55002865-55002887 GATGATGGTGAGGATGGTGATGG + Intronic
907710413 1:56875702-56875724 GGTGATGGGTAGGTAGGTGATGG + Intronic
907797194 1:57729420-57729442 ACTGAAAGGGAGGAAGGATAAGG + Intronic
908864941 1:68537172-68537194 TCAGGTGGAGAGGAAGGAGAGGG + Intergenic
909187126 1:72502160-72502182 GCAGAAGGGGAGGGAGAAGAGGG - Intergenic
909647932 1:77938027-77938049 GGTGATGGAGAGGAAGAGGAAGG + Intronic
909663001 1:78104656-78104678 GCTAAAGGGGAGAAGGGAGAAGG + Intronic
910549851 1:88463212-88463234 TGTGATGGGGAGAAAGGAGGAGG - Intergenic
910769599 1:90817557-90817579 ACAGATGTGGAGGAAGCAGATGG - Intergenic
910892069 1:92028872-92028894 GCTGAGGAGGAGAAAGAAGAAGG - Intergenic
911459703 1:98173984-98174006 GCACATGGGCAGGAAGGAGTGGG - Intergenic
911583444 1:99662052-99662074 ACTAATGGGGAAGAAGGAAAAGG + Intronic
911647498 1:100352341-100352363 GCTGCTGCGGAGAAAGGAGCGGG + Intronic
911657784 1:100464255-100464277 GCTAATGGGGAGGGTGGGGAGGG - Intronic
911739149 1:101368473-101368495 GCTGATGGGTGGGATGGAGCAGG - Intergenic
912140750 1:106723188-106723210 GGGGAGGGGGAGGAAGGAAAGGG - Intergenic
912201314 1:107461367-107461389 GCTGAAAGGCAGGAAGGAGCTGG + Intronic
912709648 1:111941325-111941347 GCAGGTGGGGAGGTAGGAGGGGG - Intronic
912935262 1:113998363-113998385 GAGGAAGAGGAGGAAGGAGAAGG + Intergenic
913261025 1:116998269-116998291 GCAAATGGGCAGGAAGGAGAAGG - Intergenic
913442473 1:118912686-118912708 GCTAATGGGAAGGAAGAGGATGG + Intronic
913452164 1:118999814-118999836 GGAGATGGGGAGGAAAGAGAGGG + Intergenic
913536706 1:119779888-119779910 TCTGAGAGGGAGGAAGCAGAGGG + Intergenic
913556161 1:119969428-119969450 GCTGTTTGGGATGAAAGAGAAGG + Intronic
913960719 1:143336484-143336506 GCTGGTGGTGAGGATGGAGAGGG - Intergenic
914055073 1:144162056-144162078 GCTGGTGGTGAGGATGGAGAGGG - Intergenic
914124073 1:144804305-144804327 GCTGGTGGTGAGGATGGAGAGGG + Intergenic
914901358 1:151712772-151712794 AGAGATGGGGAGCAAGGAGAGGG + Intronic
915015999 1:152734461-152734483 GCTGTTAGGGAGGAAGAAGCAGG - Intergenic
915079468 1:153341873-153341895 GCTGATGGAGAGGAAGAAAAGGG + Intronic
915096897 1:153469520-153469542 GCTAATGGAGAGGAAGGACCTGG - Intergenic
915232571 1:154456555-154456577 GATGAGGAGGATGAAGGAGAGGG + Intronic
915443281 1:155960029-155960051 CCTGCTGGGGTTGAAGGAGATGG - Intronic
915677414 1:157544497-157544519 GCTGATGGGCTGGAAGGAGCTGG + Exonic
915953861 1:160207420-160207442 GCTGATGGCGAGGAGGGGAATGG - Intronic
915973132 1:160367709-160367731 CCAGATGGGGAGCACGGAGAGGG + Intronic
915994632 1:160550381-160550403 GCTGGTGGGGACACAGGAGAGGG + Intronic
916057305 1:161076584-161076606 GCAGATGAGTAGGATGGAGAAGG - Intronic
917440759 1:175066985-175067007 GCTGCTGGAGGGAAAGGAGAAGG - Intergenic
917736728 1:177928023-177928045 GCTGCGGAGGAGGAAGAAGAGGG + Intronic
918716723 1:187798216-187798238 GGTGGAGGGGAGGAAGCAGATGG + Intergenic
919084813 1:192909514-192909536 GATGATGGTGAGGTAGGAGGTGG + Intergenic
919176716 1:194028420-194028442 GGGGAGGGGGAGGAAGGAGGAGG - Intergenic
919989115 1:202696910-202696932 GGTGATGGGGAGGAAAGGTATGG - Intronic
920034469 1:203056886-203056908 CCTGTTTGGGAAGAAGGAGAAGG + Exonic
920116912 1:203628013-203628035 CCCAAAGGGGAGGAAGGAGAAGG + Intronic
920260089 1:204683462-204683484 GATGAGGGGGAGGAGGAAGAGGG + Intronic
920304415 1:205009490-205009512 GGAGATGGTGAGGAGGGAGATGG - Intronic
920516660 1:206589539-206589561 GCTGATGTGTGGGAAAGAGAAGG + Intronic
920642216 1:207763390-207763412 GCAGACGGGAAGGAAGGGGATGG - Intronic
921080370 1:211734280-211734302 GCTGAGGAGGAGGAAGAAGAGGG + Intergenic
921813854 1:219544881-219544903 GCTGATCGGGAAGTAGGAGGAGG + Intergenic
922271947 1:224043275-224043297 GCTGGAGGGGAGGGAGGGGAGGG - Intergenic
922691194 1:227693005-227693027 GCTGATGGGGCAGAAGGGTATGG - Intergenic
923482408 1:234397379-234397401 GCGGAGGGGGAGGACGGGGATGG + Intronic
923500762 1:234561630-234561652 GGAGATGGGGTTGAAGGAGAGGG + Intergenic
924148138 1:241098303-241098325 ACTGATGGGGAGTAAGGAAAGGG - Intronic
1062803174 10:395094-395116 GCTGGGGGGGAGGGAGGAGTTGG + Intronic
1062877358 10:953954-953976 GCTGATTCGGAGCAAGGGGAAGG + Intergenic
1062886376 10:1019636-1019658 GCTGCTGGAGAGGGAGGCGAGGG - Exonic
1062938820 10:1406935-1406957 GCTTCTGGGGAGGATGGGGATGG - Intronic
1063097084 10:2917785-2917807 TCTGATATGGAGGAGGGAGAGGG - Intergenic
1063159252 10:3407935-3407957 GCTCTTGGGGAGGATGAAGATGG + Intergenic
1063179573 10:3585596-3585618 GCTGTGGGCGAGGAAGGAGCTGG + Intergenic
1063567539 10:7184057-7184079 GCTAATGGGAAGGAAGTGGAAGG - Intronic
1063654101 10:7969904-7969926 TTTGAATGGGAGGAAGGAGACGG - Intronic
1063766571 10:9148352-9148374 GATGAAGGGGAGGAGGGAGAGGG - Intergenic
1063967274 10:11356120-11356142 TCTCATGGGGAGGAATGAGGGGG - Intergenic
1064114556 10:12567220-12567242 GCTGAAGGAGAGGATGGAAAAGG - Intronic
1064329353 10:14379302-14379324 GCTTGTGGGAAGGGAGGAGATGG - Intronic
1064635269 10:17358777-17358799 GATGATGAGGAAGAAGGAGGAGG + Intronic
1064696934 10:17976031-17976053 GCTACTGGGGAGGTGGGAGAGGG + Intronic
1064705568 10:18069517-18069539 GCTGATATGGAGGCAGGATAGGG - Intergenic
1064859646 10:19814466-19814488 GCTGAAGCGGAGGAAGAGGAGGG + Intergenic
1064963760 10:20994865-20994887 GCTGAGGAGGAGGAGGTAGAGGG + Intronic
1065111628 10:22445431-22445453 GCTGTTGGGGATGGAGGTGATGG + Intronic
1065735389 10:28746749-28746771 GGTGATGGGGGGTAAGGGGAGGG - Intergenic
1065928721 10:30459458-30459480 GCTGCTGAGTAGGAAGGAGCTGG + Exonic
1066237118 10:33496246-33496268 GCTGAGGAGGAGGAAGAGGAGGG + Intergenic
1066334615 10:34463156-34463178 GGGGAAGGGGAGGAAGGAAAAGG + Intronic
1067029156 10:42868738-42868760 GCTGGTGGTGAGGATGGAAAGGG - Intergenic
1067217638 10:44316353-44316375 AGTGATGGGGAGGAAGTGGATGG - Intergenic
1067663717 10:48255863-48255885 GCTCATGGTGAGGGAGGTGAGGG + Intronic
1067713623 10:48670789-48670811 GCTGGTGGAGGGGAAGGTGAAGG - Intergenic
1067786528 10:49253499-49253521 GCTGGGTGGGAGGAAGGAGGAGG + Intergenic
1067901206 10:50243619-50243641 GCTTATGGGCAGGAGGGAGCTGG + Intronic
1068063846 10:52103398-52103420 GCTGAGGGGGAGGAAGGAGAGGG - Intronic
1068316535 10:55351031-55351053 GGGGAGGGGGAGGAGGGAGAGGG - Intronic
1068567014 10:58587585-58587607 GGAGATGGTAAGGAAGGAGAAGG + Intronic
1068624908 10:59232994-59233016 CCTGATGGGGAGGAAAGTAAAGG + Intronic
1068631162 10:59298952-59298974 GCTGGTGGGGAGGAAGGAGGTGG + Intronic
1068744403 10:60513932-60513954 GCTGAGGTGGAGGAAGGGGAAGG - Intronic
1069776722 10:70931626-70931648 GCTGATGTGGAAGGAGGGGAAGG - Intergenic
1069776740 10:70931736-70931758 GCTGATGTGGAAGGAGGGGAAGG - Intergenic
1069862990 10:71482760-71482782 GCTCATCCGGAGGAAGCAGAGGG + Intronic
1069870869 10:71532174-71532196 GCTGTTGTTGGGGAAGGAGAAGG - Intronic
1070150508 10:73802192-73802214 GGAGGTGGGGAGGAATGAGAGGG - Exonic
1070282770 10:75061952-75061974 GCTGATTTGGAGGAGGGAGAAGG + Intergenic
1070388781 10:75950732-75950754 GGTGATAGGGAGGAAGAATAGGG - Intronic
1070551687 10:77495352-77495374 CCTGATGCGGAGGTAGCAGAAGG - Intronic
1070555922 10:77527725-77527747 GCTGGTGGGGAGTGAGGAGGAGG + Intronic
1070585428 10:77762455-77762477 GGGGAAGGGGAGGAAGGAGGGGG - Intergenic
1070593520 10:77817146-77817168 CCTGGTGGAGAGGAAGGACAGGG - Intronic
1070605483 10:77895259-77895281 AATCCTGGGGAGGAAGGAGAAGG - Intronic
1070706599 10:78643593-78643615 TCTGCTGGGGAGGAAGGAAGAGG + Intergenic
1070794734 10:79210043-79210065 GCTGGGGGGGCGGAGGGAGAAGG - Intronic
1070824232 10:79381551-79381573 GGTGATGGGGAGGAGGCAGGGGG - Intergenic
1070836749 10:79452255-79452277 GCTGGTGGGAATGGAGGAGAAGG - Intergenic
1071420512 10:85492653-85492675 GCTGCTGGAAGGGAAGGAGACGG + Intergenic
1071445787 10:85745567-85745589 GGTGGTGGGGTCGAAGGAGAGGG + Intronic
1071521454 10:86333829-86333851 GCTGAGGGGGAGGAATAAGAGGG + Intronic
1071602416 10:86964794-86964816 GGTGATGGGGGTGAGGGAGAGGG + Intronic
1072540139 10:96392144-96392166 CTAGATGGGGAGGAGGGAGAAGG + Intronic
1072613043 10:97031674-97031696 GATCCTGCGGAGGAAGGAGATGG + Exonic
1072687192 10:97544932-97544954 GCTGAGGAGGAGGAAAGGGAGGG + Intronic
1073033980 10:100550234-100550256 GCTGAGGGGTGGGAGGGAGAAGG + Exonic
1073073449 10:100809024-100809046 GCAGATGGGGAGGAGGAACAGGG - Intronic
1073077454 10:100833150-100833172 GCTAATGAGGAGGACTGAGAGGG + Intergenic
1073735936 10:106346344-106346366 GGTGATGAGTAGGATGGAGATGG + Intergenic
1074230478 10:111529618-111529640 GAAGATGGGGAAGAAGAAGAAGG + Intergenic
1074780116 10:116796501-116796523 GGGGATGGGGAGGCAGGAGCAGG - Intergenic
1074794507 10:116928160-116928182 GCTGAAGGGTAGGAAGGAGTAGG + Intronic
1075112186 10:119596522-119596544 GGGGGTGGGGAGGAAGGGGAGGG + Intronic
1075575136 10:123572524-123572546 GAGGACGAGGAGGAAGGAGAGGG + Intergenic
1075622360 10:123937186-123937208 GCTAATGTGGAGAAAGGAGCTGG + Intronic
1075661573 10:124200554-124200576 AATGATGGGGAGGAAAGAGAAGG + Intergenic
1075683970 10:124351125-124351147 GCTGAGGAGGAGGAAGAAGAGGG - Intergenic
1076034256 10:127185796-127185818 GCTGATGGGAGAGAAGGAGATGG + Intronic
1076318906 10:129564279-129564301 AAGGAGGGGGAGGAAGGAGAGGG - Intronic
1076318910 10:129564292-129564314 GGAGAGGGGGAGGAAGGAGGGGG - Intronic
1076502104 10:130945437-130945459 GCAGATGGCCAGGAAGAAGAAGG - Intergenic
1076516295 10:131046637-131046659 TCTCCTGGGGAAGAAGGAGAAGG + Intergenic
1076604601 10:131681300-131681322 GCTCCAAGGGAGGAAGGAGAGGG - Intergenic
1077076851 11:705985-706007 GGTGTTGGGGAGGACGCAGAGGG + Intronic
1077271986 11:1685713-1685735 GCAGGTGGGGAGGAAGGGCAGGG - Intergenic
1077273530 11:1692847-1692869 GCTGAGGAGCAGGAAGGAGATGG + Intergenic
1077438529 11:2556679-2556701 GTTGATGGGGTGAAGGGAGAGGG + Intronic
1077549787 11:3194998-3195020 GCTGAGGGCTGGGAAGGAGAAGG + Intergenic
1077552495 11:3207142-3207164 GGTGATGGTGAGGATGGTGATGG + Intergenic
1077998905 11:7477030-7477052 GAGGAGGAGGAGGAAGGAGAAGG + Intergenic
1078127389 11:8581119-8581141 GTTGATGGGAAGGAAGGAAAAGG - Intronic
1078140942 11:8692602-8692624 GGAGATGGGGAGGAGGAAGAGGG + Intronic
1078285289 11:9947483-9947505 GCTGATGGGGAAGAAGGGTGTGG + Intronic
1078313474 11:10270491-10270513 GCTGAGGAGGAGGAAGAGGAAGG + Intronic
1078434402 11:11312515-11312537 GCTGAGGAGGAGGAAGAGGAGGG + Intronic
1078437628 11:11338575-11338597 GCAGATCTGGAGGAAGAAGATGG + Intronic
1078672251 11:13376066-13376088 GCTGCTGTGGAGGAAGGGGTTGG + Intronic
1078720404 11:13878814-13878836 GATGAGAGGGAGGAAGAAGATGG + Intergenic
1079450926 11:20599238-20599260 GCTGTAGAGGAGGAAGGAGGGGG - Intergenic
1079929589 11:26541295-26541317 GCGGGTGGGGAGGTAGGGGAGGG + Intronic
1080103764 11:28490047-28490069 GAAGAAGGGGAGGAAGCAGAAGG + Intergenic
1080115962 11:28621861-28621883 GGTGATGGGGAGGAGGAAGGAGG - Intergenic
1080161211 11:29179303-29179325 GGAGATGGGGAGGAAGTAGGGGG - Intergenic
1080599179 11:33805983-33806005 GCACATGGGCAGCAAGGAGAAGG + Intergenic
1080884084 11:36349532-36349554 GTTCATGGGAAGGAAGGCGAGGG + Intronic
1081356614 11:42121594-42121616 GCTGCTGAGGTTGAAGGAGAAGG - Intergenic
1081576707 11:44323168-44323190 GCTGCTGGGGAGAAGGGAGAAGG - Intergenic
1081637898 11:44733011-44733033 GCAGATGGGGAAGAGGGAGAAGG + Intronic
1081853621 11:46290576-46290598 ACTTGTGGGGTGGAAGGAGATGG - Intronic
1082269560 11:50155258-50155280 GGGGATGGGGAGGAAGGGGAAGG - Intergenic
1082899281 11:58228216-58228238 GCAGATGAGCAGGAAGGGGATGG + Exonic
1083208644 11:61168699-61168721 CCTGATGCAGGGGAAGGAGATGG - Intergenic
1083414047 11:62513815-62513837 GGTGGTGGGTAGGATGGAGAAGG - Intronic
1083886174 11:65574470-65574492 CCTGCCGGGAAGGAAGGAGAAGG + Intergenic
1083996657 11:66276367-66276389 GCAGATGGGCCAGAAGGAGATGG - Exonic
1084434060 11:69127676-69127698 GGTGCTGGGGTGGATGGAGATGG + Intergenic
1084565578 11:69926617-69926639 GCTGGAGGGGAGGAAGGAGATGG + Intergenic
1084597253 11:70124328-70124350 GCTGAGGGGGAGGAAGCAGTGGG - Exonic
1084733563 11:71089891-71089913 GGTCAAGGGGAGGAAGGAGGAGG + Intronic
1084805170 11:71573727-71573749 GCTGATGTAGATGAAGCAGAGGG - Intergenic
1084929835 11:72546212-72546234 TCTGGTGGGGAGGATGGAAAGGG - Intergenic
1084971430 11:72774334-72774356 GCTGAGGGGCAGGAAGGCAATGG + Intronic
1086451155 11:86918264-86918286 GCTTATTGGGAGAGAGGAGAAGG + Intronic
1086520099 11:87659449-87659471 TCTCATGGTGAGGAAGGAAAGGG + Intergenic
1086559267 11:88148316-88148338 GTTGATGGAGAGGAAGAAAAGGG - Intronic
1086598170 11:88600180-88600202 GATAAATGGGAGGAAGGAGATGG - Intronic
1086827645 11:91519123-91519145 GAGGAAGGGGAGGAAGGAGAGGG + Intergenic
1087140779 11:94763762-94763784 GCTGAGGAGGAGGAAGAAGGGGG + Intronic
1087754186 11:102037601-102037623 GGTGGTGGGGTGGAAGGGGAGGG + Intergenic
1088324319 11:108586493-108586515 GAGGATGGGGAGGGAGGAAAGGG - Intronic
1088324367 11:108586597-108586619 GAGGATGGGGAGGGAGGAAAGGG - Intronic
1088393478 11:109341851-109341873 GGGGGTGGGGAGCAAGGAGAGGG - Intergenic
1088423605 11:109675805-109675827 TTTGGTGGGGAGGATGGAGAGGG + Intergenic
1088677025 11:112204547-112204569 TCTGAGGGGGAGGAAGAAGAGGG - Intronic
1088769236 11:113016435-113016457 GCTGCTTGGGTGGAAGGAGGTGG - Intronic
1089113119 11:116072555-116072577 GGAGATGGAGAGGAAGGAGGAGG + Intergenic
1089182058 11:116590008-116590030 ACAGGTGGGGAGGAAGTAGAGGG - Intergenic
1089268333 11:117282889-117282911 GCTGGAGGTGAGGAAGGAGTGGG + Intronic
1089333226 11:117704557-117704579 GCTGATTGGCAGGGAGGAGCAGG + Intronic
1090102535 11:123815299-123815321 GCTGCTGGGCTGGCAGGAGATGG - Intergenic
1090168716 11:124579370-124579392 CCTGAGGAGGAGGAAGAAGAGGG + Intergenic
1090204858 11:124878487-124878509 GCTGCTGGGGAGGAAGGGGAGGG + Intronic
1090331904 11:125939217-125939239 GCTGAGGAGCAGGAAGGAGTGGG - Intergenic
1090429702 11:126635529-126635551 GGAGATAGGGAGGGAGGAGAAGG + Intronic
1090933335 11:131319416-131319438 GAAGATGAAGAGGAAGGAGAAGG - Intergenic
1091184911 11:133638387-133638409 GCTGGTGGGGAGGGAAGGGAAGG - Intergenic
1091375469 12:22256-22278 GCTGCTGGGGAGGAAGAAGCAGG + Intergenic
1091636285 12:2199334-2199356 ACTGAGGAGGAGGAAGGGGAGGG - Intronic
1091689214 12:2584324-2584346 GGTGATGGGGAGGAAGGGGAGGG + Intronic
1091912726 12:4244929-4244951 GGTGATGGGGAAGGAGGAGGGGG - Intergenic
1092014745 12:5149373-5149395 GGTGCTGGGGAGTTAGGAGATGG + Intergenic
1092061150 12:5551586-5551608 GTGTATGGGGTGGAAGGAGAGGG - Intronic
1092229678 12:6769605-6769627 CCTGAAGGAGAAGAAGGAGAAGG + Exonic
1092277895 12:7076142-7076164 GGTGATGGGGTGGGTGGAGATGG - Intergenic
1092278769 12:7083132-7083154 GTTGAGGGGGAGAATGGAGAGGG + Intronic
1092518384 12:9240120-9240142 GGTGATGGTGAGGAAGAGGATGG - Intergenic
1092527158 12:9316207-9316229 GCTACTGGGGAGGAGGGAGCAGG + Intergenic
1092540114 12:9415566-9415588 GCTACTGGGGAGGAGGGAGCAGG - Intergenic
1092796101 12:12111364-12111386 GGTGATGGTGAGGAAGAGGACGG + Intronic
1093180894 12:15966032-15966054 GTTGCTGGGGATGAAGGAAAAGG - Intronic
1093252252 12:16821115-16821137 GGAGGTGGGGAGCAAGGAGAGGG - Intergenic
1093509897 12:19914143-19914165 GCTAATGGGGAGGAAGGATGAGG - Intergenic
1093715197 12:22374090-22374112 GCTGATGGAGAGGGAGGAGAGGG - Intronic
1093730021 12:22556635-22556657 GCTGATAGCCAGGAAGGAAATGG + Intergenic
1093852188 12:24054250-24054272 AGTGAAGGGGAGGGAGGAGAAGG - Intergenic
1094036763 12:26080277-26080299 GCTGAAGGGGTGGGAGGATAGGG + Intergenic
1094054344 12:26253765-26253787 TCTGATGGGGAAGAAGTAAAGGG - Intronic
1094132332 12:27087538-27087560 GATGAAAGGAAGGAAGGAGAAGG - Intergenic
1094274374 12:28654616-28654638 GGGGATGGGGAGTAAGGGGAGGG - Intergenic
1094512926 12:31106890-31106912 GCTACTGGGGAGGAGGGAGCAGG + Intergenic
1095206331 12:39443487-39443509 GCTGCTGGGCAGGGAGGCGAGGG + Intergenic
1096221101 12:49828476-49828498 GCTGCTAGGGAGGAGGGAGGCGG - Intronic
1096640517 12:52990680-52990702 GTTCATGGGGACGGAGGAGAAGG + Intergenic
1096795705 12:54076282-54076304 ATTCATGGGGAGGAAGGAGAGGG + Intergenic
1096976891 12:55704285-55704307 TCTGATGGGGTGGAGGGGGAGGG + Intronic
1097167792 12:57094829-57094851 GCAGGTGGGGAGGCAGGAGAAGG - Exonic
1097322054 12:58236804-58236826 GCTGAGGGGGAGGAAGAACGTGG + Intergenic
1097399652 12:59113677-59113699 TCTTATGCGGAGAAAGGAGAGGG + Intergenic
1097622261 12:61954109-61954131 GGAGGTGGGGAGGAAGGTGAGGG - Intronic
1097697424 12:62787913-62787935 AGTGATGAGGAGGAAGGAAAGGG - Intronic
1097790683 12:63812051-63812073 GGGGAAGGAGAGGAAGGAGAAGG + Intergenic
1097913461 12:64995196-64995218 TTTGGTGGGGAGGGAGGAGAGGG + Intergenic
1097923648 12:65104708-65104730 GGTGGTGGGGTGGAAGGAGGAGG - Intronic
1098170840 12:67745275-67745297 GTTGGTGGAGAGGAGGGAGAAGG + Intergenic
1098191428 12:67953243-67953265 GGTGGTAGGGAGGAGGGAGAAGG + Intergenic
1098194933 12:67989716-67989738 GCTGTGAGGGAGGAAGAAGAAGG + Intergenic
1098286967 12:68917097-68917119 GCTGGAGGGGAGAAAGGAGAAGG - Intronic
1098306924 12:69111572-69111594 GCTGAGGAGGAGGAGGAAGAGGG - Intergenic
1098542373 12:71671040-71671062 GCTGAGGAGGAGGAGGAAGAAGG + Intronic
1098578227 12:72069196-72069218 GAGGAAGGGGAGGAAGAAGAAGG - Intronic
1098844008 12:75512891-75512913 GCTGATAGGGATTAAGGGGAGGG + Intergenic
1098922244 12:76313227-76313249 ACAAATGGGGAGGAAGGCGAGGG - Intergenic
1098986074 12:77013729-77013751 GCTGAGGAAGAGGAAGGAGAAGG - Intergenic
1099238403 12:80110394-80110416 GGTGATGGGGAGCAAGGGGAGGG - Intergenic
1099790549 12:87329195-87329217 GCTGTTGGGATGGAGGGAGAGGG + Intergenic
1099927657 12:89037802-89037824 GCTGATTGTGAGGAGGGAGGGGG - Intergenic
1100027669 12:90149948-90149970 GCTCATGGGGAGAGAGGAAATGG + Intergenic
1100129520 12:91474192-91474214 GGGGATGGGAAGCAAGGAGAGGG + Intergenic
1101199692 12:102421515-102421537 GTGGGTGGGGAGGAAGGAAAAGG + Intronic
1101421468 12:104554619-104554641 ACTGCTGGGGAGGATGGAGGAGG + Intronic
1101471877 12:105005046-105005068 GTTGAGGAGGAGGAAGCAGAGGG + Intronic
1101528932 12:105556925-105556947 GCTGAGGTAGAGGAAGGAAATGG - Intergenic
1101545286 12:105706656-105706678 GCAGATGGGGAGGAGGGATGAGG - Intergenic
1101673324 12:106896666-106896688 GGGGAAGGGGAGGAAGGGGAGGG + Intergenic
1101706530 12:107225731-107225753 GAGGAGGGGGAGGAAGGAGGAGG + Intergenic
1102047674 12:109840008-109840030 GATGATGGGGAGGAGGGAAGAGG - Intergenic
1102142022 12:110622909-110622931 GCTTTTGGGGAGGATGGGGAGGG - Intronic
1102230233 12:111257210-111257232 TGGGAGGGGGAGGAAGGAGAGGG - Intronic
1102533029 12:113560826-113560848 GGTGATGGAGAGGAAGGAGATGG - Intergenic
1102534546 12:113570786-113570808 GCTGGTGGAGATGAGGGAGAAGG - Intergenic
1102829803 12:115987334-115987356 GGTGATGGTGAGGAAGAGGAGGG - Intronic
1102984088 12:117264676-117264698 GGAGATGGGGAGGATGAAGAGGG - Intronic
1102988583 12:117298481-117298503 GGGGATGGGGAGGGAGGACATGG - Intronic
1102990606 12:117313125-117313147 GCCGAGGAGGAGGAAGAAGATGG - Intronic
1103021975 12:117541311-117541333 GCTGATGTGGAGGCATGGGAGGG + Intronic
1103412464 12:120722168-120722190 GAGGATGTGGAGGAAGGAGGAGG + Exonic
1103610870 12:122123512-122123534 GCTCACGGAGAGGAAGAAGAGGG + Intronic
1103743439 12:123106791-123106813 GGTTATGGAGAGGAAGTAGAGGG - Intronic
1103913722 12:124365421-124365443 GCTCATCTGCAGGAAGGAGATGG - Intronic
1103934289 12:124467232-124467254 GGTGATGGGGATGAAGATGAGGG - Intronic
1103941711 12:124504863-124504885 GGTTGTGGGGAGGGAGGAGAGGG + Intronic
1103942543 12:124508884-124508906 GCTGATGGGGGGACAGGAGGTGG + Intronic
1104315492 12:127696461-127696483 GCTGATGTGGATGGAGGTGATGG + Intergenic
1104329610 12:127832212-127832234 GATGATGGGGAGGATGATGATGG - Intergenic
1104598221 12:130134265-130134287 GGTGCTGGGGAGGGAGGAGCTGG - Intergenic
1104874531 12:132024763-132024785 GCTGCTGTCGAGGAAGGTGAGGG - Intronic
1104955529 12:132463548-132463570 GCTGATGGTGATGATGGTGATGG - Intergenic
1104955532 12:132463575-132463597 GCTGATGGTGATGATGGTGATGG - Intergenic
1104955608 12:132464367-132464389 GCTGATGGTGATGATGGTGATGG - Intergenic
1104992551 12:132634308-132634330 GACGATGAGGAGGAAAGAGATGG - Exonic
1105015325 12:132783307-132783329 GGCCATGGGGAGGAATGAGAGGG - Intronic
1105309014 13:19189884-19189906 GCTGATGGAAGGGAATGAGAAGG - Intergenic
1105421206 13:20253867-20253889 CCTGTTGGGGAGGAAGGGGTGGG + Intergenic
1106007393 13:25783674-25783696 GGTGAAGGGGTGGGAGGAGAGGG + Intronic
1106220020 13:27738685-27738707 GCTGAGGAGGAGGAAGAGGAGGG - Intergenic
1106356394 13:28987447-28987469 GATGAGGGAGAGGAAGGAGATGG + Intronic
1106375500 13:29182912-29182934 GCTGAAGGGGAGGGAGCAGGGGG + Intronic
1106763978 13:32895406-32895428 GAGGAGGAGGAGGAAGGAGAAGG - Intergenic
1106780301 13:33052328-33052350 TGTGATGGGGAAGATGGAGAAGG + Intronic
1106925281 13:34606899-34606921 GGAGAAGGAGAGGAAGGAGAAGG + Intergenic
1106943246 13:34799686-34799708 GCTGCTGAGGGTGAAGGAGAAGG - Intergenic
1106954863 13:34925383-34925405 CCTGATGGAGAGGAAGGACAGGG + Intergenic
1107104893 13:36632492-36632514 GCTGCTGGGATGGAAGGAGATGG + Intergenic
1107114426 13:36731492-36731514 GCTGATGGCCATGAAGGAAATGG - Intergenic
1107222140 13:37995572-37995594 GCTGATGAGGGTGAAGTAGAAGG - Intergenic
1107815762 13:44243134-44243156 GATGATGGAGAGGAAGAGGATGG - Intergenic
1107906796 13:45068856-45068878 GGTGCTGAGGAGGCAGGAGATGG + Intergenic
1108649395 13:52460822-52460844 CCTTTTGGGGAGGAAGAAGAGGG - Intronic
1108847542 13:54695447-54695469 GGGGAGGGGTAGGAAGGAGATGG + Intergenic
1109222590 13:59655432-59655454 GCTGAGGAGGATGAAGAAGAGGG - Intergenic
1109717005 13:66231320-66231342 GCTGATAAGGGTGAAGGAGAAGG + Intergenic
1109880769 13:68471752-68471774 GCTGATTGGGAGTGAGCAGAAGG - Intergenic
1110385901 13:74910555-74910577 GCTTATGGGAAGGAAGAAGCAGG - Intergenic
1110463470 13:75773671-75773693 GCTGATTTGGAGGCAAGAGATGG + Intronic
1110516447 13:76418403-76418425 AAGGAAGGGGAGGAAGGAGAGGG + Intergenic
1110625910 13:77655439-77655461 GCGGATGTGGAGAAAGGGGAAGG - Intergenic
1110810184 13:79803977-79803999 GGTGACTGGGGGGAAGGAGAAGG + Intergenic
1110965541 13:81690272-81690294 GGTGATGGTGAGGAAGAGGATGG + Intergenic
1111396347 13:87672933-87672955 GAAGAAGGGGAGGGAGGAGAGGG - Intronic
1111873168 13:93860055-93860077 GTTGATGGGAAGGAAGAAGGAGG - Intronic
1111956189 13:94761211-94761233 GGAGATGGGGAGAAAGGGGAAGG - Intergenic
1112044951 13:95587352-95587374 GTTGAAGGAGAGGAAGGAGTTGG - Intronic
1112168838 13:96948443-96948465 ACTGATGGCGAGGAAGAAGAAGG - Intergenic
1113672586 13:112185066-112185088 CCTGATGATGAGGAAGGAGATGG + Intergenic
1113677021 13:112214618-112214640 GCTGGAGGGGAGGAGGGGGATGG + Intergenic
1113677033 13:112214646-112214668 GCTGGAGGGGAGGAGGGGGATGG + Intergenic
1113677055 13:112214728-112214750 GCTGGAGGGGAGGAGGGAGATGG + Intergenic
1113677064 13:112214756-112214778 GCTGGAAGGGAGGAGGGAGATGG + Intergenic
1113677075 13:112214784-112214806 CCTGGAGGGGAGGAGGGAGATGG + Intergenic
1113677093 13:112214840-112214862 GCTGGAGGGGAGGAGGGACATGG + Intergenic
1113677110 13:112214895-112214917 CCTGGAGGGGAGGAGGGAGATGG + Intergenic
1113677254 13:112215311-112215333 GCTGGAGGGGAGAAGGGAGATGG + Intergenic
1113728987 13:112626187-112626209 GCTGCTGGGGAGGCTGCAGAAGG + Intergenic
1113909880 13:113836736-113836758 GAGGAGGGGGAGGAAGAAGATGG + Intronic
1114071856 14:19116745-19116767 CATGATGGAGAGGAAGGACAGGG + Intergenic
1114090402 14:19283219-19283241 CATGATGGAGAGGAAGGACAGGG - Intergenic
1114197696 14:20493627-20493649 GATGAAGAGGAGGCAGGAGAAGG - Intergenic
1114258669 14:21022704-21022726 GAGGAGGGGAAGGAAGGAGAGGG + Intronic
1114372480 14:22105435-22105457 GGTGATGATGAGGAAGGAGGAGG + Intergenic
1114499752 14:23159934-23159956 CCTGAGGGTGAGGAAGGAGAAGG + Intronic
1115091160 14:29577549-29577571 GCTGTTAGAGTGGAAGGAGAAGG - Intronic
1115123460 14:29965416-29965438 GCTGATGAGGAGGAAGACAACGG - Intronic
1115164403 14:30431445-30431467 GGTGAAGGGAAGGAAGGGGATGG - Intergenic
1115240789 14:31249974-31249996 GCTGCTAAGGATGAAGGAGAAGG + Intergenic
1115581611 14:34764776-34764798 GTTGATGGCGATGAAGAAGAAGG - Exonic
1115864790 14:37732933-37732955 GCTGAGGCAGAGGAAGAAGAGGG + Intronic
1116757121 14:48961971-48961993 TCTGATAGGGAGGACAGAGATGG - Intergenic
1117149005 14:52866373-52866395 GCTGTTGGGGAGAAAGTGGAGGG - Intronic
1117218952 14:53581926-53581948 GCTGAGGGAAAGGGAGGAGAGGG - Intergenic
1117376113 14:55119906-55119928 GCTGATTGGGAGGAAGGATCAGG - Intergenic
1117693816 14:58338560-58338582 GGTGGTAGGGATGAAGGAGAGGG + Intronic
1118196001 14:63626795-63626817 GCTGATGGGGTGTCAGGAAATGG + Intronic
1119022219 14:71125288-71125310 GCTGCTAAGGGGGAAGGAGAAGG - Intergenic
1119309411 14:73633894-73633916 GCTGAAGAGGAGGGAGGAGGGGG - Intergenic
1119441026 14:74628951-74628973 CCAGCTGGGGAGGAAGGAGGAGG + Intergenic
1119573370 14:75695883-75695905 GGGGAAGGGAAGGAAGGAGAGGG - Intronic
1119774471 14:77239851-77239873 GTGGATGGGGAGGAAGGAGCTGG - Intronic
1120213663 14:81659258-81659280 GAGGAAGGGGAGGAAGGAGATGG - Intergenic
1120636053 14:86952300-86952322 GGGGATGGGGAGCAAGGGGAGGG + Intergenic
1120723896 14:87916651-87916673 GCTGCAGTGGAGGAAGGAGCAGG + Intronic
1120733357 14:88027054-88027076 GCTGATGGTGAGGGAGGAAGTGG + Intergenic
1121372062 14:93368389-93368411 GATGATGGGGAGTGGGGAGAAGG + Intronic
1121708281 14:96017590-96017612 GGTGAAGGAGAGGAAGGACAGGG - Intergenic
1122935414 14:104953784-104953806 GCACAGGGGGATGAAGGAGATGG - Exonic
1124697067 15:31872098-31872120 GCTGGTGAGGATGAAGGAAAGGG - Intergenic
1124861293 15:33444494-33444516 ACATATGGGGATGAAGGAGATGG + Intronic
1125049000 15:35275551-35275573 GGGGGTGGGGAGCAAGGAGAGGG + Intronic
1125500693 15:40238909-40238931 GCTGAAGGGGAGGAGGAGGAAGG - Intronic
1125617823 15:41031485-41031507 GAGGGAGGGGAGGAAGGAGAAGG + Intronic
1125852933 15:42921334-42921356 GCTGATGCTGAGGAAGAGGATGG - Intergenic
1125997287 15:44174904-44174926 GGGGGTTGGGAGGAAGGAGAGGG + Intronic
1126112207 15:45181976-45181998 GCTGGGTGGCAGGAAGGAGAGGG - Intronic
1126711274 15:51459303-51459325 GGTGATGGGAAGGAAAGAAAAGG + Intronic
1126892213 15:53218589-53218611 GCTGCTGTGGAGGAAGGTCAGGG + Intergenic
1127265452 15:57357210-57357232 GCTGAGGAGGAGAAAGAAGAGGG - Intergenic
1127547122 15:60002174-60002196 GGTCCTGGGGAGGAAGGAGCTGG - Intergenic
1127572596 15:60258957-60258979 CCTGAAGGGGAGGTAGGAGTGGG - Intergenic
1127581961 15:60346826-60346848 GCCGATGGGAAGCACGGAGAAGG - Intergenic
1127647074 15:60969561-60969583 GCTGGTGGACAGGATGGAGAAGG + Intronic
1127649753 15:60995487-60995509 GGTCAGGGGGAGGAAGGGGAGGG - Intronic
1127733320 15:61819700-61819722 GCTGAGAGGAAGGATGGAGAAGG - Intergenic
1127841480 15:62835808-62835830 GCAAACTGGGAGGAAGGAGAAGG - Intronic
1127966961 15:63929716-63929738 GCTGAAGAGCAGGATGGAGATGG - Intronic
1128052375 15:64675402-64675424 GATGCTGGGGAGGATGGGGAGGG + Exonic
1128129040 15:65213376-65213398 GCTGGTGGCCAGGAGGGAGACGG - Intergenic
1128308381 15:66614921-66614943 ACAGATGGGGAGGAATGAGAGGG + Intronic
1128519573 15:68366559-68366581 GGGGAGAGGGAGGAAGGAGAGGG - Intronic
1128606357 15:69039287-69039309 GGAGATGGGGAGGAGGCAGAGGG + Intronic
1128726801 15:69993978-69994000 GCTGAGGAGGAAGAAGGAGAGGG - Intergenic
1129221377 15:74133637-74133659 GTTGGGGCGGAGGAAGGAGAGGG + Exonic
1129264479 15:74386556-74386578 CCTGATGAGGAGAGAGGAGAAGG + Intergenic
1129319824 15:74768298-74768320 GCGGCTGGAGGGGAAGGAGATGG - Intergenic
1129373749 15:75114595-75114617 GCTTTTGGTGAGGAAGGTGAAGG + Intronic
1129413919 15:75364322-75364344 TGTGAAGGGGAGGAGGGAGACGG - Intronic
1129522331 15:76193756-76193778 GCTGGTGGGGAGGCAGGGGCAGG - Intronic
1129604100 15:77016382-77016404 GCTGAGGGGTGGGAAGGGGAGGG + Intronic
1129655715 15:77524561-77524583 TCAGATGGGGAGGAAGGAGGGGG - Intergenic
1129695271 15:77737425-77737447 GAGGAAGGGGAGGAAGGAGAGGG + Intronic
1129868691 15:78927539-78927561 GATGGTGGCGAGGCAGGAGATGG - Intronic
1129898021 15:79122892-79122914 GCTGATGGGAAGGCTGGGGAGGG + Intergenic
1130225668 15:82056534-82056556 ACAGATGCGGAGGAAGGGGAAGG + Intergenic
1130226482 15:82062417-82062439 GCTGAAGGGAAGGAAGAGGAGGG + Intergenic
1130552281 15:84897780-84897802 TCTGAAGGGGAGGAGGGAGGCGG - Intronic
1130682496 15:86008882-86008904 GCAGGTGGGGAGAAAGGGGAGGG + Intergenic
1130750375 15:86705136-86705158 GCTGGTGGGGGGCAAGGGGAGGG + Intronic
1130900556 15:88204022-88204044 GCAGGTGGGGAGAAAGGGGAGGG - Intronic
1130903243 15:88223005-88223027 GAGGAGGGAGAGGAAGGAGATGG + Intronic
1131014181 15:89043631-89043653 GAGGAGGAGGAGGAAGGAGAAGG + Intergenic
1131131971 15:89906034-89906056 GCTACTGGGGAGGAAGAGGAAGG - Intronic
1131251932 15:90836736-90836758 GATGAGGGGGAGGAAGTGGATGG - Intergenic
1131351353 15:91703132-91703154 ACTGAAGGTGAGGAAGGAAAGGG - Intergenic
1131519794 15:93105603-93105625 TCTAATGGTGAGGAAGGAGAGGG - Intergenic
1132299802 15:100768506-100768528 GCTGATGGGGAGGGAGGCTCAGG - Intergenic
1132393331 15:101454606-101454628 GCTGTGGGGGAGGGAGGAGTGGG + Intronic
1132425122 15:101709567-101709589 GCAGGTGGGCAGGAAGGAGCAGG - Intronic
1132452848 15:101977805-101977827 CCTGAGGCTGAGGAAGGAGAAGG - Intergenic
1132454049 16:12821-12843 CCTGAGGCTGAGGAAGGAGAAGG + Intergenic
1132685023 16:1158628-1158650 GCTGGGGAGGAGGGAGGAGATGG + Intronic
1133280897 16:4664754-4664776 GCTGTGGTGGACGAAGGAGATGG + Exonic
1133580713 16:7141967-7141989 GAAGATGGAGAAGAAGGAGAAGG - Intronic
1133863992 16:9624646-9624668 GCAGAAGGCGAGGTAGGAGAAGG - Intergenic
1133885744 16:9825997-9826019 GGAGAGGGGGAGGAATGAGAGGG + Intronic
1134128060 16:11629972-11629994 GGTGTTGGGGAGGGAAGAGAAGG + Intronic
1134375237 16:13665987-13666009 AACGAGGGGGAGGAAGGAGAAGG + Intergenic
1134385735 16:13770620-13770642 GAGGAAGGAGAGGAAGGAGAGGG + Intergenic
1134422072 16:14102996-14103018 GCAGATGTGGAAGAAAGAGAGGG - Intronic
1134804440 16:17112718-17112740 GTTCATGGGGAAGAAGGAGCAGG + Intronic
1135168901 16:20165653-20165675 CCTGGTGGGGAGGTGGGAGAAGG + Intergenic
1135232067 16:20717879-20717901 GGAGAAGGGGAAGAAGGAGAAGG + Intronic
1135354952 16:21761323-21761345 GTTGGTGGGGAGGAGGCAGATGG - Intergenic
1135453436 16:22577465-22577487 GTTGGTGGGGAGGAGGCAGATGG - Intergenic
1135490002 16:22900837-22900859 GACGATGGGGTGGGAGGAGATGG + Intronic
1135539036 16:23315966-23315988 GATGATGGTGAGGATGGTGATGG - Intronic
1135539050 16:23316047-23316069 GGTGATGGTGAGGATGGTGATGG - Intronic
1135539076 16:23316200-23316222 GGTGATGGTGAGGATGGTGATGG - Intronic
1135539104 16:23316368-23316390 GATGATGGTGAGGATGGTGATGG - Intronic
1135539123 16:23316494-23316516 GGTGATGGTGAGGATGGTGATGG - Intronic
1135539149 16:23316653-23316675 GATGATGGTGAGGATGGTGATGG - Intronic
1135664853 16:24327013-24327035 GGTGATGGGGATGAAGGAGGTGG + Intronic
1135923831 16:26674698-26674720 GCTGATGGGGAAGAGAAAGAGGG + Intergenic
1136068015 16:27771657-27771679 GCTGGTGGGGCGGGAGGAGAAGG - Intronic
1136375257 16:29861629-29861651 GCTTAGAGGGAGGATGGAGAGGG - Intronic
1136511304 16:30739572-30739594 GGTGAGGAGGAGGAAGGGGATGG + Exonic
1136580312 16:31147535-31147557 GGTGATGGGGATGATGGGGATGG + Intronic
1136609564 16:31357952-31357974 GCTGATGGGGAAGAAAGATAAGG + Intronic
1136626061 16:31462817-31462839 GCTGGTGAGGAGGAAGAAGAGGG + Exonic
1136932334 16:34430640-34430662 GAAGAGAGGGAGGAAGGAGAGGG - Intergenic
1136972238 16:34981174-34981196 GAAGAGAGGGAGGAAGGAGAGGG + Intergenic
1138137911 16:54539569-54539591 GATGATGGGCAGGAAGGAGATGG - Intergenic
1138158936 16:54735272-54735294 GATGATAGGCAGGAAGGTGAGGG + Intergenic
1138439961 16:57028263-57028285 GATGGTGGGGAGGAACGAGGAGG - Intronic
1138520812 16:57569924-57569946 GCTGATGGAGGTGGAGGAGATGG - Intronic
1138543229 16:57701103-57701125 GGTAAGGGGGAGGAAGGAGAAGG + Intronic
1138568601 16:57852361-57852383 GCTGATGATGAGGCAGGAGGTGG - Intronic
1138657808 16:58500939-58500961 CCTGCTGGGGAGGAACGAGGAGG + Intronic
1138699502 16:58847047-58847069 GCAGAGGGAGAGGAGGGAGAGGG + Intergenic
1138706936 16:58924792-58924814 GCTGTTGGGGAGGCAGAAGTGGG - Intergenic
1139322159 16:66123614-66123636 GTTGAGAGGGAGGAAGGGGAGGG + Intergenic
1139328152 16:66167665-66167687 GCTCATGGGGCGGAAGCAGGAGG + Intergenic
1139473675 16:67191957-67191979 GAAGTTGGGGAGGAATGAGAAGG - Intergenic
1140170452 16:72598889-72598911 ACTGAGTGGGAGGAAGGAGAGGG + Intergenic
1140170458 16:72598918-72598940 ACTGAGTGGGAGGAAGGAGAGGG + Intergenic
1140315404 16:73891479-73891501 GCTACTGAGAAGGAAGGAGAGGG + Intergenic
1140824001 16:78689156-78689178 GTTGGTGGGGTGGAAGTAGAGGG - Intronic
1140866925 16:79070609-79070631 GCTGCTAGGGAGGAAGGAAGAGG + Intronic
1141217086 16:82034783-82034805 GCTGAAGGGTTGGATGGAGAGGG - Intergenic
1141461948 16:84183046-84183068 GCTGATGAGAAAGGAGGAGATGG - Intronic
1141667044 16:85470995-85471017 GCTGGTGGGGAGGAGGGCGCTGG + Intergenic
1142118247 16:88372131-88372153 GATGATGGGGATGATGGTGACGG - Intergenic
1142118263 16:88372239-88372261 GATGATGGGGATGATGGTGATGG - Intergenic
1142118282 16:88372362-88372384 GATGATGGGGATGATGGTGATGG - Intergenic
1142137752 16:88459526-88459548 GAGGAAGGGGAGGAAGGAGAAGG - Intronic
1142164314 16:88577583-88577605 GATGATGAGGAGAAAGGCGAAGG + Exonic
1142207563 16:88791290-88791312 GGGGAGGGGAAGGAAGGAGAGGG + Intergenic
1142341541 16:89526307-89526329 GCTGGGGGGCAGAAAGGAGAGGG - Exonic
1203141650 16_KI270728v1_random:1771232-1771254 GAGGATGGGGAGGAATGAGGGGG + Intergenic
1142497318 17:313126-313148 GCAGATGGAGAGGAATTAGAGGG - Intronic
1143020429 17:3914700-3914722 TGTGATGGTGAGGAAGGAGAAGG + Intronic
1143165733 17:4896454-4896476 GGTGTTGGGGAGGAAGATGATGG - Exonic
1143185597 17:5008188-5008210 GCTGAAAGGAAGGAAGGAGCAGG + Intronic
1143187537 17:5019733-5019755 GCTGCTGGGGAGGATAGAGGTGG + Intronic
1143283054 17:5769106-5769128 GGTGGTGGGGAGCAAGGGGAGGG + Intergenic
1143296639 17:5876273-5876295 GGGGATGGGGAGGAGGGGGAAGG + Intronic
1143403493 17:6660684-6660706 GCAGAGGGAGATGAAGGAGAGGG + Intergenic
1143500619 17:7336624-7336646 GATGAGGGGGAAGGAGGAGAGGG - Exonic
1143649910 17:8256967-8256989 GTGGATAGAGAGGAAGGAGATGG - Intronic
1143704523 17:8687512-8687534 GGGGAAGGGGAGGAAGGGGAGGG - Intergenic
1143803379 17:9404198-9404220 GCTGAGGAGGAGGAAGAAAAGGG + Intronic
1143819613 17:9549716-9549738 GGAGATGGGGAGGAGGGAGATGG + Intronic
1143876189 17:9992406-9992428 GAAGATGAGGAGAAAGGAGAAGG + Intronic
1143940580 17:10536960-10536982 GCAGATGTGGAGGAAGAAGTAGG + Intronic
1144235670 17:13258086-13258108 GGAGAAGGGGAAGAAGGAGAAGG - Intergenic
1144235676 17:13258113-13258135 GGAGAAGGGGAAGAAGGAGAAGG - Intergenic
1144409297 17:14985002-14985024 GCTGAGGAGGAGGAAGAGGAGGG - Intergenic
1144563913 17:16344284-16344306 GTTGAAGGGTAGGGAGGAGAGGG - Intronic
1144579464 17:16450245-16450267 GCTGATGGGAAGGCAAGAGAAGG + Intronic
1144586287 17:16489859-16489881 GCTGATGGGGGGGTGGGAGGGGG - Intronic
1144728059 17:17511639-17511661 GCTGATGGGGAGGAAGACGTGGG + Intronic
1145302465 17:21650281-21650303 GGTGATGGTGAGGAAGGTGATGG + Intergenic
1145302491 17:21650472-21650494 GGTGATGGTGAGGATGGTGATGG + Intergenic
1145304229 17:21663862-21663884 GATGATGGTGAGGATGGTGATGG + Intergenic
1145347854 17:22053042-22053064 GGTGATGGTGAGGAAGGTGATGG - Intergenic
1145347864 17:22053135-22053157 GATGATGGTGAGGATGGTGATGG - Intergenic
1145415729 17:22712244-22712266 GATGATGGTGAGGATGGTGATGG + Intergenic
1145415736 17:22712304-22712326 GATGATGGTGAGGATGGTGAAGG + Intergenic
1145415745 17:22712391-22712413 GGTGATGGTGAGGAAGATGACGG + Intergenic
1145415769 17:22712597-22712619 GGTGATGGTGAGGATGGTGATGG + Intergenic
1145926244 17:28649245-28649267 GCTTTTGGTGAGGAAGGTGAAGG - Exonic
1145963936 17:28903620-28903642 GCAGAAGGGAAGGAAGGAGAAGG - Intergenic
1145988903 17:29066289-29066311 TCTGCTGGGGAGCAAGGAGTAGG + Intergenic
1146675849 17:34773371-34773393 GCTGAGGGTGGGGAAGGAGAAGG + Intergenic
1146701248 17:34962062-34962084 GAAGAGGAGGAGGAAGGAGATGG + Exonic
1147033348 17:37660075-37660097 GAGGATGGGGAGGAATGTGAAGG + Intergenic
1147184345 17:38705469-38705491 GCGGAGGAGGAGGAAGGAGGAGG + Intergenic
1147337387 17:39735786-39735808 GGGGTTGGGGAGGAGGGAGAGGG - Intergenic
1147416867 17:40298252-40298274 ACTGATGGGGAAAAAGGAGGAGG - Intronic
1147498867 17:40942860-40942882 GAGGAAGAGGAGGAAGGAGAAGG - Intergenic
1147499505 17:40949127-40949149 GCTGATGGTGAAGATGGAAATGG + Intergenic
1147566272 17:41538140-41538162 GCTGAGGGAGGGGAAGGACAAGG + Intergenic
1147710917 17:42463991-42464013 GCTGAGGAGGAGGAAGGGGAGGG + Intronic
1147740741 17:42669896-42669918 GGTGAGGGGGAGAAGGGAGAAGG - Exonic
1148102136 17:45098697-45098719 CCAGATGGGGAGCATGGAGAGGG + Intronic
1148102189 17:45099046-45099068 GCAGAAGGGGAGGAGGGAGGAGG + Intronic
1148105862 17:45118492-45118514 GCTGCAGGGGTGGCAGGAGAGGG + Exonic
1148233308 17:45950566-45950588 GGAGATGGGGTGGAGGGAGAAGG - Intronic
1148324779 17:46776902-46776924 GGAGAGGGGGAGGAAGGAGGAGG - Intronic
1148355392 17:46972253-46972275 GAAGATGGGATGGAAGGAGAAGG - Intronic
1148558074 17:48590511-48590533 GCTGGTGAGGAGGAAGCCGAGGG - Intronic
1149295875 17:55262465-55262487 GCTGCTCAAGAGGAAGGAGAGGG - Intergenic
1149511173 17:57243053-57243075 ATTGAAGGGAAGGAAGGAGAGGG - Intergenic
1149526694 17:57361720-57361742 GCTGATGAGAAGGAAGAAGAGGG + Intronic
1149760072 17:59220917-59220939 CCTGAGGGGAGGGAAGGAGAGGG + Intronic
1149863652 17:60138648-60138670 TTTGTTGGGGACGAAGGAGAGGG - Intergenic
1150128525 17:62653733-62653755 GCTGTTGGGGAGGAGGGAGGAGG + Intronic
1150138113 17:62706872-62706894 GCTGAAAGGGAAGGAGGAGAGGG + Intronic
1150210923 17:63441059-63441081 CCTGGTGGGAAGGAAGGAGTGGG - Intronic
1150633178 17:66894620-66894642 GCTCATGGGGTGGAGGGGGAAGG - Intergenic
1151086211 17:71384051-71384073 GGGGATGGGGAGGAGGGAAATGG + Intergenic
1151146091 17:72042860-72042882 TCTGATGGTGATGATGGAGAGGG - Intergenic
1151235881 17:72719583-72719605 GCTGTTGGGGAGGACGGACAGGG + Intronic
1151317805 17:73334837-73334859 GCTGGTGGGCAGGAAGGTAAAGG - Exonic
1151352392 17:73539479-73539501 GCTGATGGGGAGAGGAGAGAGGG + Intronic
1151423235 17:74012683-74012705 TCTTTTGGGGAGGAAGCAGATGG - Intergenic
1151845499 17:76651738-76651760 GGTGATGGTGAGGAAGAGGATGG - Intergenic
1151935215 17:77257159-77257181 GGTGATGGGGATGAAGGAAGTGG - Intergenic
1151935240 17:77257254-77257276 GGTGATGGGGATGAAGGAGATGG - Intergenic
1151935278 17:77257404-77257426 GGTGATGGAGATGAAGGAGGTGG - Intergenic
1151935297 17:77257477-77257499 GGTGATGGGGATGGAGGAGGTGG - Intergenic
1151976099 17:77484245-77484267 GATGATGGGGATGATGGTGATGG + Intronic
1152336721 17:79703116-79703138 GAGGAAGGGGAGGAAGGAGGAGG - Intergenic
1152470808 17:80489362-80489384 GGTGGAGGGGAGGGAGGAGAGGG + Intergenic
1152470885 17:80489611-80489633 GGTGGAGGGGAGGGAGGAGAGGG + Intergenic
1152470962 17:80489860-80489882 GGTGGAGGGGAGGGAGGAGAGGG + Intergenic
1152471002 17:80489982-80490004 GGTGGAGGGGAGGGAGGAGAGGG + Intergenic
1152551270 17:81031538-81031560 GCTGGTCGGGAAGAGGGAGACGG + Intergenic
1152594304 17:81230757-81230779 ATTGATGAGGAGGAAGAAGAGGG - Intronic
1152646909 17:81473442-81473464 GCTGGGGGGGAGGGAGGTGATGG - Intergenic
1152655572 17:81517778-81517800 GCCTCTGGGGAGGAAGGAGTGGG - Intronic
1153003133 18:474442-474464 ACTGATGGGCAGGAAAGACAAGG + Intronic
1153025362 18:667446-667468 GGTGATGGTGATGATGGAGATGG + Intronic
1153429341 18:4999078-4999100 GCTGCTGGGGATGAAGGAGGGGG - Intergenic
1153558045 18:6337890-6337912 TGGGATGGAGAGGAAGGAGAAGG + Intronic
1153629373 18:7054741-7054763 GCTGAGGAGGAGGAGGAAGAGGG - Intronic
1154049030 18:10935796-10935818 GCTGCTGGCGAGGCAGGAGCAGG - Intronic
1154105819 18:11521771-11521793 ACTGATGGGTATGAAGGTGAGGG - Intergenic
1154347542 18:13555404-13555426 GATGAGGGGAAGGAGGGAGAAGG - Intronic
1154373158 18:13784762-13784784 GCTGAGGAGGAGGAAGTGGAGGG - Intergenic
1154465764 18:14641816-14641838 GCCGAGTAGGAGGAAGGAGAAGG - Intergenic
1154971629 18:21415556-21415578 GAGAATGGGAAGGAAGGAGAAGG + Intronic
1155152820 18:23135956-23135978 GATGTTGGTGAGGAAGGAGAGGG - Exonic
1155229297 18:23757424-23757446 GCTGGAGAGGAGGAAGGGGAGGG - Intronic
1155263427 18:24067657-24067679 GTTGAGGGGGTGGGAGGAGATGG - Intronic
1155385834 18:25276208-25276230 GTGGAGGGGGAGGAAGGGGAAGG - Intronic
1156261793 18:35451426-35451448 AGTGATGGGGAAGAGGGAGAGGG + Intronic
1156463220 18:37333311-37333333 GTGGAGGGGGAGGAGGGAGAGGG - Intronic
1156490884 18:37495346-37495368 GCTGTTGGAGAGGAGGGAGGTGG - Intronic
1156706538 18:39889287-39889309 GGGGAAGGGGAGGGAGGAGAGGG - Intergenic
1157055462 18:44223248-44223270 GCTGATGGAGATCATGGAGAGGG - Intergenic
1157298442 18:46462418-46462440 GCTGATGTGGAGGGAGGAAGTGG + Exonic
1157305815 18:46516857-46516879 GGTGATAGGGATGAAGGTGATGG - Intronic
1157323767 18:46654636-46654658 TGTGATGGGGAGGAAGAAGGAGG - Intronic
1157445520 18:47743760-47743782 GCTGAGGAGGAGGAAGAGGAAGG - Intergenic
1157556042 18:48613456-48613478 GAGGAAGGGGAGGAAGGCGAAGG + Intronic
1157683950 18:49628059-49628081 GCTGGGGAGGAGGAAGGAGAGGG + Intergenic
1158381730 18:56938052-56938074 ACTGAGGGGGAGGAAGTGGAGGG + Intronic
1158494582 18:57942903-57942925 GTTGATGGGGAGGAAAGACATGG + Intergenic
1158518127 18:58147674-58147696 GCATATGGTGAGGAGGGAGACGG + Intronic
1158610491 18:58935443-58935465 GGAAATGGGGAGGAGGGAGAAGG - Intronic
1159467969 18:68810831-68810853 GGTGGTGGGGAGCAAGGGGAGGG - Intronic
1159753227 18:72328693-72328715 GCTGAGGAGGAGGAAGAAGAGGG + Intergenic
1160038164 18:75320483-75320505 TCTGATGCGGGGGAAGGGGAAGG - Intergenic
1160060852 18:75527540-75527562 GCAGTTGGGGAGGAAGAGGAAGG - Intergenic
1160139400 18:76307624-76307646 GCTGACTGGGAGGAAGGATGGGG - Intergenic
1160242649 18:77133951-77133973 GCTGAAGGTGAGGAGGGAAAAGG + Intergenic
1160376770 18:78419858-78419880 GGTGATGGGGAGGCTGGAGACGG - Intergenic
1160409798 18:78667847-78667869 GTGGATGGGGAGGAGTGAGAGGG - Intergenic
1160448683 18:78947139-78947161 GAGGAGGGGGAGGAAGGAGGAGG + Intergenic
1160565434 18:79784067-79784089 GAGGAGGGGGAGGAAGAAGAGGG + Intergenic
1160965279 19:1744641-1744663 GAGGAGGGGGAGGAAGCAGAGGG - Intergenic
1160965690 19:1746083-1746105 AAGGATGGGGAGGAGGGAGAAGG + Intergenic
1161078600 19:2299216-2299238 GCTGCCGGGGAGGCAGGAGGGGG + Intronic
1161081784 19:2314355-2314377 TCTGTTGGGGAGGGTGGAGAGGG - Intronic
1161146342 19:2680916-2680938 GCTCACGGGGAGGTAGGACATGG - Intronic
1161262333 19:3344949-3344971 GCTGCAGCGGAGGGAGGAGAGGG + Intergenic
1161415785 19:4145623-4145645 GAGGAAGGGGAGGAAAGAGAAGG + Intergenic
1161885120 19:6988616-6988638 GATGATGGTGATGATGGAGATGG + Intergenic
1162153966 19:8664361-8664383 GCTGATGGGCAGGAAGTGGGGGG - Intergenic
1162277709 19:9670664-9670686 CCAGAAGGGTAGGAAGGAGACGG + Intronic
1162309167 19:9895021-9895043 GGGGGTGGGGAGGATGGAGATGG - Intronic
1162498288 19:11035589-11035611 AGTCATGGGGAGGGAGGAGAGGG + Intronic
1162581604 19:11534605-11534627 GGAGAAGGGGAAGAAGGAGAAGG + Intergenic
1163163912 19:15482321-15482343 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
1163164028 19:15483098-15483120 GCTGAGGGGGAGGAAGGGAAGGG - Intronic
1163554725 19:17985368-17985390 GCCAATGGAGAGGAAGGTGATGG - Exonic
1163693236 19:18749102-18749124 ACTGATGGGGAGAAAGCACAAGG - Intronic
1164476501 19:28579656-28579678 GCAGAGGGTGAGGAAGGAAAGGG + Intergenic
1164567674 19:29339518-29339540 GAGGAGGAGGAGGAAGGAGAAGG + Intergenic
1164591851 19:29511815-29511837 GGGGATGAGGAGAAAGGAGAGGG + Intergenic
1164591858 19:29511837-29511859 GGGGATGAGGAGGAAGAAGAGGG + Intergenic
1164591895 19:29511979-29512001 GAGGATGAGGAGGAAGGAGGGGG + Intergenic
1164591901 19:29512022-29512044 GAGGATGAGGATGAAGGAGAGGG + Intergenic
1164591991 19:29512357-29512379 AAGGATGAGGAGGAAGGAGAGGG + Intergenic
1164592001 19:29512401-29512423 GAAGATGAGGAGGAAGGAGAGGG + Intergenic
1164592008 19:29512422-29512444 GGGGATGAGGAGGAAGGTGAGGG + Intergenic
1164592016 19:29512462-29512484 GAAGATGAGGAGGAAGGAGAGGG + Intergenic
1164592053 19:29512586-29512608 GGGGATGAGGAGGAAGGAGGGGG + Intergenic
1164592090 19:29512734-29512756 GGGGATGAGGAGGAAGGAGGGGG + Intergenic
1164592095 19:29512754-29512776 GGGGATCAGGAGGAAGGAGACGG + Intergenic
1164592154 19:29512992-29513014 GGGGATGAGGAAGAAGGAGAGGG + Intergenic
1164592159 19:29513014-29513036 GAGGATGAGAAGGAAGGAGAGGG + Intergenic
1164592169 19:29513057-29513079 AAGGATGAGGAGGAAGGAGAGGG + Intergenic
1164592174 19:29513079-29513101 GGAGATGAGAAGGAAGGAGAGGG + Intergenic
1164592181 19:29513101-29513123 GGGGATGAGGAGAAAGGAGAGGG + Intergenic
1164592197 19:29513143-29513165 GGGGATGAGGAGGAAGGAGAGGG + Intergenic
1164592203 19:29513164-29513186 GGGGATGAGGAGAAAGGAGAGGG + Intergenic
1164592211 19:29513186-29513208 GGGGATGAGGAGGAAGGAGAGGG + Intergenic
1164592238 19:29513272-29513294 GGGGATGAGGAGGAAGGAGAGGG + Intergenic
1164592249 19:29513315-29513337 GGGGATGAGGAGGAAGGAAAGGG + Intergenic
1164592272 19:29513422-29513444 GGGGATGAGGAGGAAGTAGAGGG + Intergenic
1164592285 19:29513464-29513486 GGGGATGAGGAGGAAGAAGAGGG + Intergenic
1164592297 19:29513507-29513529 GTGGATGAGGAGGAAGAAGAGGG + Intergenic
1164592306 19:29513528-29513550 GGGGATGAGGAGGAAGGAGGGGG + Intergenic
1164592313 19:29513556-29513578 GAGGATAAGGAGGAAGGAGAGGG + Intergenic
1164592328 19:29513605-29513627 GAGGATAAGGAGGAAGGAGAGGG + Intergenic
1164592344 19:29513670-29513692 GGAGATGAGGAGGAAGGAGAGGG + Intergenic
1164592360 19:29513711-29513733 GGGGATGAGGAGGAAGGAGGGGG + Intergenic
1164592368 19:29513731-29513753 GGGGATGAGGAGGAAGGAGGGGG + Intergenic
1164592376 19:29513751-29513773 GGGGATGAGGAGGAAGGAGGGGG + Intergenic
1164592388 19:29513791-29513813 GGAGATGAGGAGGAAGGAGAGGG + Intergenic
1164592392 19:29513813-29513835 GGCGATGTGTAGGAAGGAGATGG + Intergenic
1164592399 19:29513836-29513858 GGGGATGAGGAGGAAAGAGAAGG + Intergenic
1164592412 19:29513879-29513901 GGGGATTAGGAGGAAGGAGAGGG + Intergenic
1164592434 19:29513963-29513985 GGGGATGAGGAGAAAGGAGAGGG + Intergenic
1164592453 19:29514027-29514049 GGGGATGAGGAGGAAGGAGAGGG + Intergenic
1164592458 19:29514049-29514071 GGTGATGAGGAGGAAGAAGAGGG + Intergenic
1164592475 19:29514115-29514137 GAAGATGAGGAGGAAGGAGAGGG + Intergenic
1164592499 19:29514200-29514222 AGGGATGAGGAGGAAGGAGAGGG + Intergenic
1164592506 19:29514222-29514244 GGGGATGAGGAAGAAGGAGAGGG + Intergenic
1164592512 19:29514244-29514266 GGGTATGAGGAGGAAGGAGATGG + Intergenic
1164592549 19:29514330-29514352 GGGGATGAGGAGGAAGGAGGGGG + Intergenic
1164592567 19:29514370-29514392 GGGGATGAGGAGGAAGGAGGGGG + Intergenic
1164592571 19:29514390-29514412 GGGGATGAGTAGGAAGGAGATGG + Intergenic
1164592588 19:29514432-29514454 GGGGATGAGGAGGAAGGAGATGG + Intergenic
1164592596 19:29514454-29514476 GGGGATTAGGAGGAAGGAGAGGG + Intergenic
1164592622 19:29514541-29514563 TGTGATGAGGAGGAAGGAGAGGG + Intergenic
1164592631 19:29514581-29514603 GAGGATGAGGAGGAAGGAAAGGG + Intergenic
1164592638 19:29514602-29514624 GGGGATGAGGAGGAAGGAGAGGG + Intergenic
1164592649 19:29514641-29514663 GCAGATGAAGAGGAAGGAGGGGG + Intergenic
1164592673 19:29514724-29514746 GGGGATGAGGAGGAAGGAGAGGG + Intergenic
1164592692 19:29514813-29514835 GAGGATGAGGAGGAAGGAGACGG + Intergenic
1164605512 19:29595195-29595217 GCTGCAGGGGAAGAAGGAGGAGG + Intergenic
1164743384 19:30593668-30593690 GGTGAGGGGCAGGGAGGAGAGGG - Intronic
1164956666 19:32392355-32392377 GAGGAAGGGGAGGAAGGGGAGGG + Intergenic
1165148825 19:33749415-33749437 GATGATGGGGAGGATGGAGGGGG - Intronic
1165675093 19:37715647-37715669 CCTGCTGGGGAGTAAGGAAAGGG - Intronic
1165770306 19:38376138-38376160 GCTGATGGGGAGGGGAGGGAGGG - Exonic
1165790596 19:38489369-38489391 GCAGAAGGGGAGAAAGAAGAAGG + Exonic
1165927536 19:39336137-39336159 GATGAGGGGAAGGAAGGAGGGGG - Exonic
1166734420 19:45075911-45075933 GCTGAGGGTGCTGAAGGAGAGGG + Intronic
1166920001 19:46222772-46222794 GCTGGTTGGGAGGATTGAGATGG - Intergenic
1166992493 19:46700997-46701019 GATGCTGGGGAGAAAGGGGAAGG - Intronic
1167199845 19:48056987-48057009 GGAGAGCGGGAGGAAGGAGAGGG + Intronic
1167494134 19:49808236-49808258 GCAGATGGGAAGGGAGGGGAAGG - Intronic
1167619147 19:50551544-50551566 GCGGAGGGGGAGGACCGAGAGGG - Intronic
1167748263 19:51365495-51365517 GCTGATGGGAAGGACAGACATGG + Intronic
1167765519 19:51479703-51479725 GCAGATGGAGAGGAGGGAGAAGG + Intronic
1167973667 19:53206067-53206089 GGGGATGGGGAGGTAGGGGAGGG - Intergenic
1168071111 19:53952376-53952398 GCTACTGGGGAGGAAGAAGTGGG + Intergenic
1168510198 19:56967517-56967539 GAGGATGAGGAGGGAGGAGAAGG - Intergenic
1168574566 19:57499335-57499357 GATGATGGAGAAGATGGAGATGG - Intronic
1168574581 19:57499491-57499513 GATGATGGAGATGATGGAGATGG - Intronic
1168574588 19:57499542-57499564 GATGATGGAGAAGATGGAGATGG - Intronic
1168574601 19:57499665-57499687 GATGATGGAGATGATGGAGATGG - Intronic
1202694555 1_KI270712v1_random:114731-114753 GCTGGTGGTGAGGATGGAGAGGG - Intergenic
925181766 2:1822116-1822138 GCTGTTGGGGAGGGAGAGGATGG - Intronic
925287476 2:2725380-2725402 GCTGATGTGGAAGGGGGAGAGGG - Intergenic
925608593 2:5684108-5684130 GCTGCTGGGGAACCAGGAGATGG - Intergenic
925616265 2:5747161-5747183 GCTGATGTGGAGGATGGAGGAGG - Intergenic
925889856 2:8424942-8424964 ACTGGTGGGGAGGAAGGAAGTGG - Intergenic
926119629 2:10235041-10235063 GCTGATGGGGAGCAGCCAGAAGG - Intergenic
926681814 2:15669799-15669821 GCTTATGAGGAGGAAGGAATCGG - Intergenic
926702025 2:15810174-15810196 ACAGATGGGGAGGGAGGAGATGG - Intergenic
926724939 2:15990254-15990276 GCAGAGGGGCAGGGAGGAGAAGG + Intergenic
926920744 2:17937437-17937459 GGAGGTGGGGAGGAAGGGGAGGG - Intronic
926985031 2:18613172-18613194 GCTGGTGGGAAGGGAAGAGAGGG + Intergenic
927168992 2:20352375-20352397 GGTGATGGGGAGCAATGAGATGG - Intergenic
927707297 2:25304427-25304449 GGGGATGGGGAGGATGGAGTGGG - Intronic
927922121 2:26981059-26981081 GCTGAGGTGGGGGAGGGAGAGGG + Intronic
928093101 2:28388301-28388323 GCTGAAAGGGAGGGAGGAGTTGG - Intergenic
928142865 2:28745658-28745680 GCTCTTGTGCAGGAAGGAGAGGG + Intergenic
928173268 2:29017195-29017217 GCTGAAGCAGATGAAGGAGATGG + Exonic
929161422 2:38836321-38836343 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
929255564 2:39807838-39807860 GGGGATGGGGGGCAAGGAGAGGG - Intergenic
929817561 2:45246945-45246967 GGTGGTGGGGAGCAAGGGGAGGG + Intergenic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
930137458 2:47916698-47916720 GGTCATGGAGAGGAAGGAAAGGG + Intergenic
930188062 2:48429666-48429688 GGTGATGGGGAGCAGGGAAAAGG + Intergenic
930344983 2:50168888-50168910 GGTGTTGGGGAGGAAAGAAAAGG - Intronic
930364675 2:50424276-50424298 GGGGAGGGGGAGGAAGAAGAAGG + Intronic
930651611 2:53970307-53970329 GCAGATGCGGAGGACGTAGAGGG + Intronic
931169877 2:59791389-59791411 GCTGAGGGAGACGAGGGAGAGGG - Intergenic
931236657 2:60418329-60418351 GCTGCTGAGGTTGAAGGAGAAGG - Intergenic
931236674 2:60418393-60418415 GCTGCTGAGGGTGAAGGAGAAGG - Intergenic
931256013 2:60573546-60573568 ACTGCTGGGGAGGAATGAGTAGG + Intergenic
931547227 2:63402315-63402337 GGGGGTGGGGAGCAAGGAGAGGG + Intronic
931607411 2:64066066-64066088 AGAGAGGGGGAGGAAGGAGACGG + Intergenic
932756544 2:74413895-74413917 TCAGTAGGGGAGGAAGGAGAAGG - Intergenic
932773151 2:74512965-74512987 TCTGCTGGGGAGAAAGGAGGGGG + Intergenic
933481377 2:82861236-82861258 GATGATGAGGAAGAAGGAGGAGG - Intergenic
933972852 2:87484111-87484133 GCTGATGTGGGGAAGGGAGAAGG - Intergenic
934080662 2:88465067-88465089 ACTCAGGGGGAGGAAGGAGGAGG - Intergenic
934275722 2:91571777-91571799 GCTGGTGGTGAGGATGGAGAGGG - Intergenic
934559732 2:95306950-95306972 GCTGCTGGGGAGGCGGGAGGAGG - Intronic
935037326 2:99391273-99391295 GCTGAGAGGGAAGAAGGAGAGGG + Intronic
935064126 2:99633439-99633461 GCTGGAGGGGAGGAAAGAAAAGG + Intronic
935184535 2:100720162-100720184 GCTGATGGGAAGTGATGAGATGG - Intergenic
935328877 2:101961972-101961994 GGGGTTGGGGAGGGAGGAGACGG + Intergenic
935473662 2:103490808-103490830 GCTGAGGAAGAGGAAGAAGAGGG - Intergenic
935582683 2:104771727-104771749 GCTGAAGGAGAAGTAGGAGAAGG + Intergenic
935644498 2:105323042-105323064 GGTGGTGAGGAGGAAGGTGAAGG + Intronic
935789235 2:106575972-106575994 GCTTGTGTGGAGGAAGCAGAGGG + Intergenic
935848008 2:107187656-107187678 GCAGTTGGGGAGGAAGCAGGTGG - Intergenic
936056858 2:109268094-109268116 GCCGATGGGGAGGAAGGGGCTGG + Intronic
936320869 2:111466102-111466124 GCTGATGTGGGGAAGGGAGAAGG + Intergenic
936992611 2:118382205-118382227 GCTGAGGAGGAGGAGGAAGAGGG - Intergenic
937141056 2:119600818-119600840 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
937197232 2:120169622-120169644 GAGGTTGCGGAGGAAGGAGAAGG - Intronic
937305471 2:120867860-120867882 GCTGGAGGGGAGGAGAGAGAGGG + Intronic
937365348 2:121257265-121257287 GCTGTAGGGGAGGCAGGAGGGGG - Intronic
937686808 2:124706831-124706853 GAGGAGGGGGAGGAAGGAGGAGG + Intronic
937699821 2:124851681-124851703 GCTGAGAGTGAGGAAGGAGAAGG + Intronic
938053501 2:128196084-128196106 GATGATGGGGAGGGCGGGGAGGG + Intergenic
938226991 2:129624849-129624871 CCTCTTGGGGAGGAAGGATAGGG + Intergenic
938486103 2:131710196-131710218 CATGATGGAGAGGAAGGACAGGG + Intergenic
938654088 2:133412947-133412969 GCAGGGAGGGAGGAAGGAGAGGG + Intronic
939018676 2:136932701-136932723 GCTGAGGAGGAGGAAGAGGAGGG + Intronic
939454594 2:142418009-142418031 GACGATGGGGAGGAGGGAGGGGG - Intergenic
939853363 2:147326637-147326659 GCTGAGGAGGAGGAAGAGGAGGG - Intergenic
940063318 2:149597450-149597472 ACTGAAGGAGAGGAAGAAGAAGG + Intergenic
940068795 2:149660853-149660875 GCTGAGGAGGAGGAAGAAAAGGG + Intergenic
940498640 2:154466251-154466273 GGTGATGAGGATGAAGTAGAAGG + Intergenic
940637897 2:156320377-156320399 GCAGCTGGGGAGGAAAGGGAGGG + Intergenic
940811164 2:158244510-158244532 GCTGATGGCCAGCAAGGAAATGG - Intronic
940858240 2:158746507-158746529 GCTGAGGGGAAGGAAGAAGGAGG - Intergenic
941033208 2:160536528-160536550 GCTGAGAGGGAGGTAGAAGAGGG + Intergenic
941104819 2:161340914-161340936 CCTGAGGAGGAGGACGGAGAAGG - Intronic
941144342 2:161824930-161824952 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
941909549 2:170750243-170750265 CCTGAAGGGAGGGAAGGAGAGGG + Intergenic
941989752 2:171543466-171543488 AGAGATGAGGAGGAAGGAGAAGG - Intronic
941990569 2:171552425-171552447 GCTAATGGGGAGACAGAAGAAGG - Intronic
942292899 2:174489231-174489253 GCTAAAGAGGAGGAAGGACAGGG + Intergenic
942350780 2:175050699-175050721 GCTGAGGAGGAGGAAGAGGAGGG + Intergenic
942642220 2:178072335-178072357 GCGGAAGGGGAAGCAGGAGATGG - Exonic
942792806 2:179779999-179780021 GCTGCTGGGGTTGGAGGAGAGGG + Intronic
943016094 2:182512181-182512203 TCTGATGGGGAGAAAGGTGCTGG - Intronic
943631102 2:190253565-190253587 ACTGATGGGGATTAAGGGGATGG - Intronic
944025419 2:195160236-195160258 GCCTTTGGGGAGGATGGAGATGG + Intergenic
944106887 2:196088826-196088848 GATAATCAGGAGGAAGGAGAAGG - Intergenic
944763394 2:202840415-202840437 GCTGGTGTGGCTGAAGGAGATGG + Intronic
945943321 2:215971139-215971161 GGGGATGGGGCGCAAGGAGAGGG + Intronic
945987510 2:216367116-216367138 GGTGATGGGGAGCAGGGAGGTGG + Intronic
946044485 2:216810204-216810226 GATGATGGGGTGGATGGAAAAGG + Intergenic
946172563 2:217904176-217904198 GCTAGTGGGCAGGAAGGAGAGGG - Intronic
946414487 2:219532954-219532976 GCTGATGGAGAGGTAGGAAAGGG - Intronic
946415185 2:219536664-219536686 GCGGCTGGGGAGGAAGGTGCCGG + Intronic
946415586 2:219538291-219538313 GAGGAAGGGAAGGAAGGAGAGGG + Exonic
946475176 2:220000190-220000212 GCTGTGGGGTAGGAAGGAGCTGG - Intergenic
946482482 2:220070410-220070432 GCTGAAGGGGAGCAAGGGGTTGG - Intergenic
946555115 2:220847830-220847852 GATGATGGAGAGGAATGAGAAGG + Intergenic
946587923 2:221211186-221211208 GCTGAGGAGGAGGAAGAGGAGGG + Intergenic
946620722 2:221559971-221559993 GCTAATGGAGAGGAAGGATGAGG - Intronic
946693393 2:222327434-222327456 GCTGAGGAGGAGGAGGAAGAGGG - Intergenic
946786262 2:223246985-223247007 ACTCATGGGGAGGAACGAAATGG - Intergenic
946915247 2:224512961-224512983 GCTGAGGAGGAGTAAGAAGAAGG - Intronic
947248346 2:228074991-228075013 GAGGAAGGGGAGGAAGAAGAGGG + Intronic
947584088 2:231341521-231341543 TCTGTTGGTCAGGAAGGAGAGGG + Intronic
947708455 2:232294921-232294943 GCTGATGGGAAGAAAACAGAAGG - Intronic
947829792 2:233130901-233130923 GCGGATGGGGTGGGAGGACATGG + Intronic
947831337 2:233143952-233143974 GGTGATGGTGAGGGTGGAGATGG + Intronic
947831464 2:233144547-233144569 GGTGATGGTGAGGGTGGAGATGG + Intronic
947878096 2:233480917-233480939 GCGGGTGAGGAGGAAGGAGGGGG + Intronic
947940859 2:234053915-234053937 GGAGATGGGGAGGGAGGGGAAGG + Intronic
948308032 2:236964250-236964272 CCTGAAGGGGAGGAAGGTGCTGG - Intergenic
948365180 2:237450160-237450182 GCTCATGGGCAGTAAGGACAAGG + Intergenic
948554281 2:238796517-238796539 GCTGATGTGGAGCAGGGAGTGGG - Intergenic
948589264 2:239038917-239038939 GCTGGTTGGCAGGAAGGAGAGGG + Intergenic
948650336 2:239439815-239439837 GGTGAAAGGGAGGAAGGAGGTGG + Intergenic
948777007 2:240294420-240294442 GCAGTTGGGGAGGCAGGAGGAGG - Intergenic
948981144 2:241495486-241495508 ACTGCAGGGGTGGAAGGAGACGG + Exonic
949053676 2:241912188-241912210 TCTGACGGGCAGGAAGGTGACGG + Intergenic
1168778885 20:471937-471959 GCTGAGGGAGAAGGAGGAGACGG + Intergenic
1169260127 20:4131794-4131816 GAAGATTGGGAGGAAGGTGAAGG + Intronic
1169284812 20:4299054-4299076 GCTCATGGGGAGGAAGGAATGGG + Intergenic
1170360469 20:15540545-15540567 GATGCTGGGGATGAAGGATAAGG + Intronic
1170614103 20:17935227-17935249 CTGGATGGGGATGAAGGAGAGGG + Intergenic
1171197486 20:23211531-23211553 GATGATGTGGAGGAAAGAGAGGG - Intergenic
1171241011 20:23566974-23566996 ACGGATAGGGAGAAAGGAGATGG - Intronic
1171251653 20:23653537-23653559 ACTGGAGGGGAGGAAGGAGAGGG - Intergenic
1171310203 20:24139416-24139438 GGTGAGGGGGAGGGAGAAGAAGG - Intergenic
1171519084 20:25761986-25762008 GGTGATGGTGAGGATGGTGATGG + Intergenic
1171521784 20:25781680-25781702 GATGATGGTGAGGATGGTGATGG + Intronic
1171555044 20:26074261-26074283 GGTGATGGTGAGAAAGGTGATGG - Intergenic
1171555057 20:26074371-26074393 GATGATGGTGAGGATGGTGATGG - Intergenic
1171557861 20:26094687-26094709 GGTGATGATGAGGAAGGTGATGG - Intergenic
1171959799 20:31485509-31485531 GCTGTGCGGGAGGAAGGAGGTGG + Intergenic
1172009802 20:31839985-31840007 GCTGGTGGGGCAGAAGGAAACGG - Intergenic
1172202105 20:33133658-33133680 GGTGATGAGGAGGAAAGAGTTGG + Intergenic
1172292122 20:33784086-33784108 GATGGGGAGGAGGAAGGAGATGG - Intronic
1172389581 20:34558098-34558120 GGTGATGGGGAATAAGGAAAAGG - Intronic
1172624639 20:36340216-36340238 GCTGTTGGGCAGCCAGGAGAAGG - Intronic
1172630108 20:36372429-36372451 GGTGATGGGGAGGGAGGTGGTGG - Intronic
1172775172 20:37403089-37403111 GCTGATGGGGAGGGCAGCGAGGG - Intronic
1172849211 20:37948498-37948520 GCTGAGGCTGAGGCAGGAGAGGG + Intergenic
1172872939 20:38147091-38147113 GGAGATGGGGAAGAAGGAGGTGG + Intronic
1173014863 20:39215780-39215802 GGTTATGGGGAAGAAGGACATGG - Intergenic
1173044945 20:39501053-39501075 GGTGATTGGAAGGAAGGAGTAGG + Intergenic
1173162696 20:40664251-40664273 GGGGATGGGGAGGATGGAGACGG - Intergenic
1173163671 20:40671174-40671196 GCTGGTGGGGAGGATGGAGCAGG - Intergenic
1173521789 20:43705381-43705403 GCTGAGGGAGAGGACGGCGAAGG - Intronic
1173669364 20:44787222-44787244 GATGATGGGGCAGGAGGAGAGGG + Intronic
1173825898 20:46047456-46047478 GCTCATGCCCAGGAAGGAGAGGG - Exonic
1174182442 20:48683282-48683304 GCTGCTGGGGCAGAAGAAGACGG + Intronic
1174361213 20:50029919-50029941 GCTGATGGTTACGAAAGAGAGGG - Intergenic
1174432957 20:50484053-50484075 GGTGGTGGGGAGGAGGGAGAGGG - Intergenic
1174495402 20:50938082-50938104 GTGGATGGGGAGGAAGGAGGTGG - Intronic
1174539173 20:51275685-51275707 GATGATGGGCAGGGAGGATATGG + Intergenic
1174643430 20:52064993-52065015 TGTGCTGGGGAGGAGGGAGAAGG + Intronic
1174774367 20:53330648-53330670 GATGATGGGGATGCAGAAGAAGG - Intronic
1174872535 20:54196350-54196372 ACTGATAGGGAGGAAGGGGAGGG + Intergenic
1175118500 20:56700943-56700965 GTTGATGGTGAGGAAGAAGATGG - Intergenic
1175367833 20:58467658-58467680 GCTGCAGGGGTGGAAGGAGATGG + Exonic
1175717737 20:61266623-61266645 GCTGGTGGGGAGTCTGGAGAGGG + Intronic
1175845182 20:62054543-62054565 GCTCTTGGGGTGGAAGGACATGG - Intronic
1175933506 20:62504535-62504557 GGTGATGGGGATGATGAAGATGG - Intergenic
1175948307 20:62568980-62569002 GCTGAGGGGTAGGGAGGAGAGGG - Intronic
1175982151 20:62744040-62744062 TTTGATGGGGAGGACGGAGGTGG - Intronic
1176649096 21:9529470-9529492 GCGGCTGGAGAGGTAGGAGAAGG - Intergenic
1176653195 21:9568086-9568108 GGTGATGGTGAGGAAGGCGATGG + Intergenic
1177136138 21:17307075-17307097 GCTGATGGGAAGGAAAGGCAGGG - Intergenic
1177297367 21:19193717-19193739 GCTGAGGAGGAGGAAAAAGAAGG - Intergenic
1177308213 21:19349373-19349395 GGTTATTGTGAGGAAGGAGAAGG - Intergenic
1177341038 21:19800617-19800639 GGGGATGGGGAGCAAGGAGAGGG - Intergenic
1177650136 21:23949658-23949680 GCAGAGGGAGAGGAAGGAGTAGG + Intergenic
1177791565 21:25728028-25728050 GCTGCTGGAGAGGAAGAAGAGGG - Intronic
1178184866 21:30207885-30207907 ACTGGTGGGGAGGAGGGGGATGG + Intergenic
1178417929 21:32418844-32418866 GCTGATGGGAGGGTAGGAAAAGG - Intronic
1178428124 21:32495422-32495444 GCCAATGGGGAGGGTGGAGAAGG + Intronic
1178527704 21:33346215-33346237 GGTTATGGGGAGAAAAGAGATGG + Intronic
1178806297 21:35842389-35842411 GCTGAGGGGGAGGAGGGAATGGG + Intronic
1178932558 21:36832254-36832276 GCTGATGAGGAGGAAGAGGATGG + Intronic
1179032307 21:37731299-37731321 GATGCTGGGGATGGAGGAGAAGG + Intronic
1179251222 21:39673360-39673382 GCTGGTGGGGAGGGAGCAGGAGG - Intergenic
1179813247 21:43885700-43885722 GCTGATTTGGAGGAAGAAAAGGG + Intronic
1180129259 21:45816467-45816489 GAGGAGGGGGAGGAGGGAGAGGG - Intronic
1180490297 22:15839100-15839122 CATGATGGAGAGGAAGGACAGGG + Intergenic
1180956689 22:19744431-19744453 GCTGGTGGAGGGGAAGGTGAAGG - Intergenic
1181114477 22:20622479-20622501 ACTTATGGGCAGGTAGGAGATGG + Intergenic
1181388328 22:22560230-22560252 GCTGATGAGAAGGCAGCAGATGG + Intronic
1181523852 22:23467001-23467023 GGTGCTGGGGAGGAAGGTGCTGG - Intergenic
1181720892 22:24773499-24773521 GTTGATGGGGATGATGCAGATGG - Intronic
1181839809 22:25647145-25647167 GAGGAGGTGGAGGAAGGAGAGGG + Intronic
1181960758 22:26620096-26620118 GCTGAGAGAGAGGAAGGAAAGGG - Intergenic
1182273237 22:29169099-29169121 GTTTATGGGGTGGAAGGAAAGGG - Intergenic
1183197446 22:36363193-36363215 CCTGTTGGGGAGGAGGGAGAAGG - Intronic
1183202617 22:36396265-36396287 GCTGTTGGGGAAAGAGGAGATGG + Intergenic
1183254403 22:36753163-36753185 GCTGATGGGGATGAGGGGTAAGG - Intergenic
1183284443 22:36953341-36953363 TCTGCTGGGGAAGGAGGAGAAGG + Intergenic
1183324740 22:37185147-37185169 GCTGAGGTGGAGGGAGTAGAGGG - Intronic
1183500753 22:38177371-38177393 GCTGATGGGGTGTGAGGGGATGG - Intronic
1183596923 22:38818395-38818417 GGTGCTGGGCAGGAAGGAGGGGG - Intergenic
1183706299 22:39476700-39476722 GCTGATGGGAATGAAACAGACGG - Intronic
1183862728 22:40681372-40681394 GGTGATGCTGATGAAGGAGAGGG - Exonic
1184047386 22:41979858-41979880 GCAGATGGGCGGGAGGGAGAGGG - Intronic
1184243088 22:43221563-43221585 GCTGATGGGGAGGAGGTAGGAGG - Intronic
1184911675 22:47539516-47539538 GCTGTTGGGATGGAAGGTGAAGG - Intergenic
1184927196 22:47651253-47651275 GCAGCTGGGGAAGGAGGAGAAGG + Intergenic
1184959367 22:47917913-47917935 GGAGGTAGGGAGGAAGGAGAAGG - Intergenic
1184981938 22:48101206-48101228 GGAGAAGGGGAGGAAGGGGAGGG + Intergenic
1185089425 22:48757400-48757422 GAGGAGGAGGAGGAAGGAGAAGG + Intronic
1185199381 22:49492210-49492232 GCAGCTGGGGAGGTAGGAGGAGG - Intronic
1185215442 22:49597391-49597413 GATGATGGGGATGATGGTGATGG + Intronic
1185366197 22:50438043-50438065 GCTGGAGGGGAGGACGGGGAGGG - Intronic
949483224 3:4513314-4513336 AGTGAAGTGGAGGAAGGAGATGG - Intronic
949876409 3:8628728-8628750 GCTGGGGGAGAGGAAGGGGATGG + Intronic
950012144 3:9731446-9731468 GCGGATAGGGAGGAGGCAGAGGG + Intergenic
950107608 3:10398277-10398299 CCTTGTGGGCAGGAAGGAGAGGG - Intronic
950297880 3:11847635-11847657 TATTTTGGGGAGGAAGGAGAGGG - Intergenic
950298268 3:11850832-11850854 GCTGATGGAGGGGAAGGAGAGGG + Intergenic
950876579 3:16280210-16280232 TCTGATGGGGAGGGTAGAGAGGG + Intronic
950900725 3:16495024-16495046 GCGGGTGGAGTGGAAGGAGACGG + Intronic
950914269 3:16627879-16627901 CTTGATGGGGTGGAATGAGATGG + Intronic
950984882 3:17351579-17351601 GCGGGTGGGGAGCAAGGGGAGGG + Intronic
951484981 3:23201641-23201663 GGTGTTGGGGAGGGAGGAGGCGG + Intergenic
951623162 3:24628955-24628977 GCTGAGGGAGAGGAAGATGAGGG - Intergenic
952505718 3:34005308-34005330 GCTGAGGAGAAGGAAGGAAAAGG + Intergenic
953306151 3:41831690-41831712 GGGGATGGGGAGCAAGGGGAGGG - Intronic
953463166 3:43097467-43097489 TGTGGTGGGGAGGGAGGAGAGGG + Intronic
953855545 3:46497064-46497086 GCTGGAGAGGAGGAAGGAGGTGG + Intergenic
953957534 3:47243414-47243436 GCAGATGTGGAGGAAGAAGAGGG + Intronic
954420598 3:50417154-50417176 GGAGATGGGGTGGGAGGAGAAGG - Intronic
954673382 3:52302667-52302689 GCTGCAGGGGAGGATGCAGAAGG - Intergenic
954732788 3:52679039-52679061 GGGGATGGTCAGGAAGGAGAAGG - Intronic
954875247 3:53798961-53798983 GGTGTTGTGGAGGAAGGACAGGG + Intronic
954946670 3:54431453-54431475 GCTGATTAGGAGGAAGAGGAAGG + Intronic
955059188 3:55481919-55481941 GCTGCCAGGGAGGGAGGAGATGG + Intronic
955382549 3:58451463-58451485 GCTGAGGAGGAGGAAGAGGAAGG + Intergenic
955403996 3:58613807-58613829 ACTGATGGGCAGGAGGCAGAAGG + Intronic
955832663 3:63020984-63021006 GCTGATGGAGGGGAATCAGAAGG - Intergenic
956270021 3:67441753-67441775 GCTGTTAGGAAAGAAGGAGAGGG + Intronic
956361756 3:68455523-68455545 CCTGATGATGAGGAAGAAGATGG - Intronic
956494994 3:69815402-69815424 GCTGAGGGGGAGAAGGAAGAGGG - Intronic
958119822 3:89270956-89270978 GCTGAAAAGGAGGAAGGGGAGGG + Intronic
958124911 3:89343456-89343478 AATGATGGGGAGAATGGAGATGG - Intronic
958729510 3:97946733-97946755 GCTGATTAGGAGGAATGAGGTGG + Intronic
958996608 3:100912960-100912982 GATGAAGGGGAGAAGGGAGAGGG + Intronic
959110004 3:102111576-102111598 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
959827442 3:110815298-110815320 GCTGAAAGGGAAGAAGGAGGTGG - Intergenic
960452933 3:117832433-117832455 GCTGGTGGAGAGGAAGGATGGGG - Intergenic
960510081 3:118539593-118539615 GGCAATGGGGAGGCAGGAGATGG + Intergenic
960607935 3:119527562-119527584 GCATATGGGGAGAAAGGAGAGGG + Intronic
960768322 3:121163422-121163444 GTGGATGGGGGGCAAGGAGAGGG + Intronic
960914036 3:122679572-122679594 CCTGGTGAGGAGGGAGGAGAGGG - Intergenic
960950125 3:122993779-122993801 GCTGTGGGGGAGGCAGGAGCGGG - Intronic
961125012 3:124409510-124409532 GCAGATTGGGAGGAAGGACAAGG + Intronic
961173348 3:124814946-124814968 GCTGATGGGGAGTGGGGAGCAGG - Intronic
961221690 3:125206026-125206048 GCAGCTGAGGAGGAAGGAAAAGG - Intronic
961245299 3:125446430-125446452 GCAGATTCGGAGGAAGGCGAGGG - Intergenic
961445986 3:126982093-126982115 GCTCCTGGGGAGGGAGGAGCGGG + Intergenic
961448211 3:126990989-126991011 GCTGCTCAGGAGGAAGGAGCAGG - Intronic
961530743 3:127538587-127538609 GCTGCTGGGGAGGAAGTATGGGG + Intergenic
961830699 3:129621629-129621651 GCAGATGCGGAGAAAGCAGAGGG - Intergenic
961940923 3:130636869-130636891 GGGGAGGGGGAGGAAGGGGAAGG - Intronic
962278624 3:134033754-134033776 GCTGCTGGGGAGGCAAGAGAAGG + Intronic
962281066 3:134052269-134052291 TCTGATGCTGAGGGAGGAGAGGG - Intergenic
962299134 3:134222082-134222104 GCTGCTGTGGTGAAAGGAGATGG - Intronic
962343949 3:134606423-134606445 AGTGGTGGGGAGGGAGGAGAGGG - Intronic
962418237 3:135203246-135203268 GCAGATGAGGAGCAAGGGGAGGG + Intronic
963123875 3:141797728-141797750 GCAGACGGGGAGAAAGGAGCCGG - Intronic
963463591 3:145648679-145648701 AGTGATGGGGAGAAGGGAGAGGG + Intergenic
963707004 3:148699485-148699507 GGTGGTGGAGAGGAAGGAGAAGG - Intronic
964030501 3:152133242-152133264 GCTTATGTAGAGGAAGGATAAGG + Intergenic
966681141 3:182643368-182643390 GATGGTGGGGAGACAGGAGAGGG - Intergenic
966985884 3:185179960-185179982 GCTGAGAAGGAGGATGGAGAAGG + Intergenic
967108018 3:186269519-186269541 GCTAAAGCTGAGGAAGGAGAAGG - Intronic
967192662 3:186998508-186998530 GCTGAGGAGGAGGAAGAGGAGGG + Intronic
967316154 3:188153866-188153888 GACGGTGGGGAGGAAGGAGGGGG + Intronic
967597872 3:191349080-191349102 GCTGATGGGGGTGGAGGAGGGGG + Intronic
967893462 3:194379570-194379592 TCTGAAAGGGAGGAATGAGAGGG - Intergenic
968163684 3:196447537-196447559 GGTGATGGGGGGTGAGGAGAGGG - Intergenic
968515493 4:1013859-1013881 GCTGAGGAGGACGAAGGCGAAGG - Intronic
968615056 4:1573959-1573981 GCTGAGGGTGAGGGAGGAGCTGG - Intergenic
968737110 4:2303378-2303400 GCAGATGGGGATGAAGGTGGGGG - Intronic
968761277 4:2443778-2443800 CCTGCTGGGGAGGCAGGAGAAGG - Intronic
969265952 4:6064126-6064148 CCTGGTGGGGAGCAAGGGGAAGG + Intronic
969370356 4:6727721-6727743 GTGGACGGGGAGGAAGGGGAGGG - Intergenic
969467546 4:7366544-7366566 GCTGATGAGGATGGAGGAGGGGG - Intronic
969595544 4:8147539-8147561 CCTTATGGGGAGGAGGGAGCGGG + Intronic
969625887 4:8305501-8305523 ACTGCTGGGAAGGAAGGTGATGG - Intronic
969838140 4:9860175-9860197 GCAGACAGGGAGGGAGGAGAAGG - Intronic
969847403 4:9930138-9930160 GGTGGAAGGGAGGAAGGAGAGGG - Intronic
971383429 4:26120951-26120973 GATGAAGGGGGGAAAGGAGAGGG + Intergenic
971784647 4:31084760-31084782 GGAGATGGGGAGGAGGGGGAGGG + Intronic
971796570 4:31236238-31236260 GGTGATGAGGTGGAGGGAGAAGG - Intergenic
972166858 4:36297139-36297161 GCTGAGGAGGAGGAAGAGGAGGG + Intronic
972500146 4:39670306-39670328 GGGGATGGGGAGCAAGGGGAAGG - Intergenic
972646726 4:40975070-40975092 TGGGGTGGGGAGGAAGGAGAGGG - Intronic
973151768 4:46897257-46897279 GGTGGTGGGGAGAAAGGAGTTGG - Intronic
973161189 4:47018806-47018828 GCTGAGGAGGAGGAAGAAGAGGG + Intronic
973267582 4:48226449-48226471 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
973309801 4:48696527-48696549 GCAGGTGGGGGGCAAGGAGAGGG + Intronic
973575381 4:52282780-52282802 GCTGAGGAGGAGGAATGGGAGGG - Intergenic
973717286 4:53689750-53689772 GCTGATAGTAAGGAAGTAGAAGG - Intronic
973875511 4:55214442-55214464 GCTGATGGGGAGGGCACAGACGG + Intergenic
973885550 4:55317455-55317477 GAAGAGTGGGAGGAAGGAGAGGG - Intergenic
974147291 4:57964576-57964598 GCTGAGGAGGAGGAGGAAGAGGG + Intergenic
974351696 4:60755842-60755864 GCAGTGGGGGAGGAAGGAGGTGG + Intergenic
974826226 4:67134175-67134197 GGAGATTGGGAGGAAGGAGAGGG + Intergenic
975424396 4:74209333-74209355 GGTGGTGGGGAGCAAGGGGAGGG - Intronic
976903026 4:90203338-90203360 GGTGGTGGGGAGCTAGGAGAGGG - Intronic
977870131 4:102081290-102081312 GCTGATTGGTAGTATGGAGAGGG - Intergenic
977901707 4:102429637-102429659 GGAGATGGGGAGGAAAGAAATGG + Intronic
978311957 4:107394521-107394543 GCTGAGGAGGAGGAAGAGGAGGG + Intergenic
978405130 4:108371114-108371136 GCTCCTAGGGAGGAGGGAGAGGG - Intergenic
978744925 4:112182114-112182136 GGTCATGGGGAAGAGGGAGAGGG + Intronic
978935607 4:114371410-114371432 GAGGAGGAGGAGGAAGGAGAGGG - Intergenic
978976688 4:114884282-114884304 GCTGCTGGGGAGGCAGGAAGAGG + Intronic
979410796 4:120376514-120376536 GCTTATGTGGTGGAAGGAAAGGG + Intergenic
979564267 4:122136511-122136533 GAGGAAGGGGAGGAAGAAGAGGG - Intergenic
980844917 4:138312827-138312849 GAGGAGGGGGAGGAAGGAGGAGG - Intergenic
980986117 4:139696156-139696178 GCTGAGGAAGAGGAAGAAGAGGG + Intronic
981313402 4:143318135-143318157 GCTGCTGGGGAGGCTGAAGAAGG + Intergenic
981448807 4:144872013-144872035 GCTGATGGGGATGATGAAAATGG - Intergenic
981532495 4:145765681-145765703 GCTGAGAGGGAGGATGAAGAGGG + Exonic
981688986 4:147485376-147485398 GATGATGGAGATGATGGAGATGG + Intronic
981741491 4:148006871-148006893 GCTGATGGGGAGGAAGGAAAGGG - Intronic
982232599 4:153222850-153222872 GCTGCGGGGGAGGAAGGAGGAGG + Intronic
982521668 4:156425007-156425029 GCTGAGGAGGAGGAAGAGGAAGG - Intergenic
982846090 4:160254166-160254188 CCTGATGGTGATGAGGGAGAAGG - Intergenic
983002895 4:162441060-162441082 GCTGATGGTGAGGATTGAAATGG - Intergenic
984514316 4:180719571-180719593 GCACATGGGGACGAAGGACAGGG + Intergenic
984850171 4:184145723-184145745 GGGGCTGGGGAGGCAGGAGATGG - Intronic
984932175 4:184857772-184857794 GGTGATGGGAAGTAAGGAGGAGG + Intergenic
985168476 4:187123223-187123245 ACTGAGGAGGAGGAAGGAGAGGG - Intergenic
985223390 4:187732042-187732064 GCTGAGGGGGAGGAGGAGGACGG - Intergenic
985307329 4:188557847-188557869 GCAGAAGAGGAGGAAGAAGAGGG - Intergenic
985333170 4:188863390-188863412 GCTGAGGAGGAGGAAGAAGAAGG - Intergenic
985657799 5:1140976-1140998 GCTGAGGGGGAGGGTGGACACGG + Intergenic
985714049 5:1445855-1445877 CCTGATGGGGAGGGAGGGAAGGG - Intergenic
985800686 5:2003864-2003886 GCTGAGGCGGAGGAAAGAGGGGG + Intergenic
985821554 5:2164063-2164085 GCCGCTGGGCAGGAAGCAGAGGG - Intergenic
985891825 5:2721858-2721880 GCTGAGGGAGAGGGAGGAGGCGG + Intergenic
985923913 5:3000807-3000829 GGTGATGGGGAGAAAGCAGGCGG + Intergenic
986221776 5:5774959-5774981 GGAGAAGGGGAGGAAGGGGAAGG - Intergenic
986445991 5:7821812-7821834 GCTGATGGAGCAGAAGGGGAAGG + Intronic
986786002 5:11114377-11114399 GCGGATGGGGAGGGAGGAATGGG + Intronic
986905583 5:12490876-12490898 GCTGCTAAGGATGAAGGAGAAGG - Intergenic
987436210 5:17896721-17896743 AGAGATGGGGATGAAGGAGAAGG - Intergenic
987737276 5:21862925-21862947 ACTGAAGGGGCTGAAGGAGAAGG - Intronic
988787618 5:34579131-34579153 GGAGAGGGGGAGGAAGGAGAAGG + Intergenic
988961414 5:36375097-36375119 GCTGATGGGGAAGCAGGAGAGGG + Intergenic
990214529 5:53515422-53515444 GCTGATTGCCAGGAAGGAGATGG - Intergenic
990407228 5:55503797-55503819 GAGGAAGGGGAGGAAGGGGAGGG + Intronic
990537405 5:56736373-56736395 GCTACTGGGGAGGAAGAAAAAGG - Intergenic
990671088 5:58130784-58130806 GCTGGTGGGGATGAAGGAGCAGG - Intergenic
990825468 5:59893457-59893479 GGTGATGGGGATGCAGGAGGCGG + Exonic
991583197 5:68177796-68177818 GCTGATGGGGAAGAATGAGTAGG + Intergenic
991966454 5:72096289-72096311 GCTGATAGGAAGAAAGCAGACGG - Intergenic
992003166 5:72454542-72454564 GATGAGGTGGAGGTAGGAGATGG + Intronic
992449216 5:76860604-76860626 GCTGATGCTGAGGAGGGACAGGG + Intronic
992515938 5:77492285-77492307 GCAGCCGGGGAGGAAGGAGGAGG - Exonic
992542927 5:77782202-77782224 GCTGAGGAGGAGGAAAAAGAGGG + Intronic
992640345 5:78763479-78763501 GCAGATGAGGAGGAATGAGAGGG + Intronic
992703985 5:79369401-79369423 GCAGGTGGGGAGGGTGGAGAGGG + Intergenic
992758956 5:79934657-79934679 GCTGGTGAGGATGAGGGAGAGGG + Intergenic
992790648 5:80210415-80210437 GCTGGTGCGGAGGACAGAGAGGG - Intronic
992944091 5:81792536-81792558 GCTGATGGAAAGGAAGGCTATGG + Intergenic
993505105 5:88699706-88699728 GAGGATGAGGAGAAAGGAGAAGG - Intergenic
994198865 5:96949939-96949961 GGTGAGGGGGAGGATGGAAAAGG - Intronic
995295119 5:110511293-110511315 GGGGGTGGGGAGTAAGGAGAGGG + Intronic
996055123 5:118973997-118974019 GGTGATGGTGAGGAAGAGGATGG + Intronic
996466967 5:123814143-123814165 GCTGTTTGAGGGGAAGGAGAGGG - Intergenic
996617777 5:125461682-125461704 TCTGATGGGGGAGTAGGAGAAGG + Intergenic
997002538 5:129779264-129779286 GCTGATGAGGAGGCAGAAAAAGG + Intergenic
997197073 5:131987454-131987476 GCACATAGGGAGGCAGGAGAAGG + Intronic
997391520 5:133520875-133520897 GCTGATGTGGAGGAAGAAGGTGG + Intronic
997526471 5:134556118-134556140 GCTGACAGGGAGGAAGGGGCAGG - Intronic
997603659 5:135157242-135157264 CCTGCTGTGGAGTAAGGAGAAGG + Intronic
997634483 5:135394881-135394903 GTGGATAGGGAGAAAGGAGAGGG + Intronic
997641721 5:135452753-135452775 GGGGACGGGGAGGATGGAGAGGG + Intergenic
998022056 5:138777910-138777932 GGAGAGGGGGAGGAGGGAGAGGG + Intronic
998022063 5:138777925-138777947 GGAGAGGGGGAGGAGGGAGAGGG + Intronic
998022070 5:138777940-138777962 GGAGAGGGGGAGGAGGGAGAGGG + Intronic
998160146 5:139808659-139808681 GCTGTCTGGGAGGAAGGAGGAGG - Intronic
998208036 5:140173479-140173501 ACTGAGGGGGAGGAAGAAGCAGG - Intergenic
998377477 5:141700777-141700799 GCTGATCCGAAGGCAGGAGAGGG + Intergenic
998384270 5:141747421-141747443 GAGGAGGGGGAGGGAGGAGAGGG + Intergenic
998399178 5:141839242-141839264 TCTTTTGGGGAGGAAGGCGAGGG - Intergenic
998675218 5:144400325-144400347 CCTGAGAGGGAGGAAGGAGGTGG + Intronic
998686184 5:144529333-144529355 GCTGAGGGGTAGGAGGAAGAGGG + Intergenic
998824200 5:146084396-146084418 GGTGTTGGGGAGTAAGGAGGAGG + Exonic
999093042 5:148954516-148954538 ATTGGTGGAGAGGAAGGAGATGG - Intronic
999096413 5:148981802-148981824 GATCTTGGGGAGGAAGCAGAGGG + Intronic
999187627 5:149724447-149724469 GCTGAGGAGGATGAAGGAGGAGG + Intergenic
999189418 5:149735494-149735516 GATGATGACGATGAAGGAGAAGG - Intronic
999353210 5:150897611-150897633 GCTGATGAGGCTGAAGGAGGAGG - Intronic
999829378 5:155304314-155304336 GAAAATGGGGAGGAAAGAGATGG - Intergenic
999869179 5:155731354-155731376 TCAGATGGGGAGGAGGGAAAGGG + Intergenic
999871946 5:155761602-155761624 GATGATGAGGATGATGGAGAGGG - Intergenic
1000037365 5:157459771-157459793 GGTGGAGGGGAGGAAGGAGAGGG + Intronic
1000330189 5:160199678-160199700 GCTAATGGAGACGAAGGAGGGGG - Intronic
1000432480 5:161167096-161167118 GTTGAAGAGGAGGTAGGAGAGGG + Intergenic
1000752477 5:165113945-165113967 GAGGATGGGGAAGAAGGGGAGGG - Intergenic
1000961496 5:167606378-167606400 GGACATGGGGAGGGAGGAGAGGG + Intronic
1001185523 5:169567812-169567834 GATGAAGAGGAAGAAGGAGAAGG - Intergenic
1001251654 5:170151642-170151664 GCTGGTTGGGAGGACGCAGAGGG - Intergenic
1001289417 5:170446063-170446085 GCTCAAGGGTAGGAAAGAGAGGG - Intronic
1001307545 5:170586374-170586396 GCTGATGGGGATGCAGAGGAGGG + Intronic
1001360310 5:171077628-171077650 GCTGATGGGCAGAAAGGAAAGGG + Intronic
1001612962 5:173018353-173018375 GCTGAGGAGGAGGAAGAAGAGGG + Intronic
1001634928 5:173202999-173203021 ACTGCTGGAGAGGAGGGAGAAGG - Intergenic
1001711765 5:173784547-173784569 GGTGATGGGGATGAAGAAGAGGG - Intergenic
1001822080 5:174718355-174718377 GCAGAAAGGGAGGAGGGAGAGGG + Intergenic
1002139506 5:177130483-177130505 CCAGATGGGGAGGCTGGAGATGG + Intergenic
1002338672 5:178499448-178499470 GCTGATGGAGATGTAGGAGGAGG - Intronic
1002527875 5:179824981-179825003 GCAGAGTGGGAGGAAGGAGAGGG + Intronic
1002655497 5:180743458-180743480 TCTGAAGGGGAGGAAAGAGATGG - Intergenic
1003074141 6:2968920-2968942 GGAGATGGGGTGGAAGCAGATGG + Intronic
1003241937 6:4352667-4352689 GCCCATGGGGAGTGAGGAGATGG + Intergenic
1003293634 6:4804534-4804556 ACTGATGGGGAGGAAGAGCAGGG - Intronic
1003298676 6:4856709-4856731 TCTGATGGGGAAGACTGAGATGG + Intronic
1003329333 6:5116828-5116850 CCTGCAGGGGAGGAAGGAGCAGG + Intronic
1003403365 6:5809101-5809123 GCTGATGGAAGGGAAGGAGAAGG - Intergenic
1004078113 6:12364028-12364050 GCTGAGGGGGAGGCAGGGCAGGG - Intergenic
1004131198 6:12921613-12921635 GAAGAAAGGGAGGAAGGAGAGGG + Intronic
1004131225 6:12921715-12921737 GAAGAAGGGAAGGAAGGAGAGGG + Intronic
1004141969 6:13026552-13026574 GTAGAGAGGGAGGAAGGAGACGG + Intronic
1005246124 6:23887381-23887403 GCTGCTGGGGCAGAAGGGGATGG - Intergenic
1005819169 6:29582879-29582901 CCTGAAGAAGAGGAAGGAGAAGG + Intronic
1005881996 6:30069154-30069176 AGTGATGAGGAGGAAGAAGAGGG + Exonic
1005964894 6:30720337-30720359 TCTGAGAGGGAGAAAGGAGAGGG - Exonic
1006075996 6:31532911-31532933 GCTGGGGGGGAGGAAGGGGGTGG + Exonic
1006109857 6:31737942-31737964 GGTGATGAGGAGGATAGAGAAGG - Intronic
1006110673 6:31743086-31743108 GCTGTGGGGGAGGAAAGAAAAGG - Exonic
1006196157 6:32243794-32243816 GCTGATGGTGAGGCGGGAGAAGG + Intergenic
1006197473 6:32254821-32254843 GCTACTGGGGAGGAGGAAGATGG + Intergenic
1006373903 6:33661331-33661353 GCTCAGCGGGAGGAAGGTGATGG + Intronic
1006415558 6:33901760-33901782 GCTGTCGGGGAGGGAGGTGAGGG + Intergenic
1006443001 6:34063640-34063662 GCTCATGGGGAGGGGGGAGAAGG + Intronic
1006499300 6:34447758-34447780 CTTGTGGGGGAGGAAGGAGAGGG - Intergenic
1006505510 6:34486282-34486304 GCTGAGAGGGAGGGAGGAGGAGG + Intronic
1006795791 6:36731641-36731663 GGATCTGGGGAGGAAGGAGATGG - Intronic
1007231574 6:40351793-40351815 GCTGGAGGTGCGGAAGGAGATGG - Intergenic
1007236252 6:40392944-40392966 GGTGGTGGGGTGGAAGGACAGGG + Intronic
1007385601 6:41518295-41518317 GCAGGTGGGGAGGCAGCAGAAGG - Intergenic
1007664027 6:43503950-43503972 GATCCTGGGCAGGAAGGAGAGGG + Intronic
1007708258 6:43804707-43804729 GAAGAGGGGGAGGAAGAAGAGGG - Intergenic
1007985349 6:46202348-46202370 AGTGATGGAGAGGAAGGAGTCGG + Intergenic
1008039440 6:46780790-46780812 GATGATGGAGAGGATGGTGATGG - Intergenic
1008069795 6:47087702-47087724 GAGGATGGGGAGCAAGGGGAGGG + Intergenic
1008124048 6:47648946-47648968 GCTGAGGAGGAGGAAGAGGAGGG - Intergenic
1008288383 6:49682520-49682542 GGAGGTGGGAAGGAAGGAGAAGG - Intergenic
1008592710 6:53010062-53010084 GTTGTAGGGGAAGAAGGAGAAGG - Intronic
1008714244 6:54269090-54269112 GTTTCTGAGGAGGAAGGAGATGG + Intergenic
1008720033 6:54337812-54337834 GCTGATGGTGCGGTAGAAGAGGG + Intronic
1008771705 6:54986783-54986805 CTTGATGGGGAGGAAGGATAAGG + Intergenic
1008876056 6:56329356-56329378 GCTGTGGGGGAGGAAAGAGATGG + Intronic
1009501732 6:64421937-64421959 CTTGATGGGGAGGATGGAGAGGG - Intronic
1009570808 6:65381467-65381489 GCAGAGTGGCAGGAAGGAGAGGG + Intronic
1009859143 6:69303420-69303442 GCTGAGGAGGAGAAAGAAGAGGG - Intronic
1010517154 6:76786943-76786965 GGGGATGGGGGGGAAGGGGAGGG + Intergenic
1011170572 6:84500177-84500199 GCTGATGTCGTGGAAGTAGATGG - Intergenic
1011410164 6:87059605-87059627 GCAGGTGGGGAGGGAGGAGGCGG + Intergenic
1011554561 6:88561194-88561216 GGAGAGGGGGAGGAAGGAGCAGG - Intergenic
1011712823 6:90071946-90071968 ACTGAGGAGGAGGAAGAAGAGGG + Intronic
1011992056 6:93534127-93534149 GGTGATGGGGAGCAAAGGGAGGG - Intergenic
1012059144 6:94455426-94455448 GAAGAGGAGGAGGAAGGAGAGGG - Intergenic
1012170918 6:96015948-96015970 GCTGGAGGGGAGGGAGGCGAGGG - Intergenic
1012525321 6:100170203-100170225 GCTGAAGGGGTGGAGGGGGAAGG - Intergenic
1012621152 6:101345263-101345285 GGGGATCTGGAGGAAGGAGAGGG + Intergenic
1012708593 6:102567621-102567643 AGTGATGGGCAGGAAGGAGTAGG + Intergenic
1013355508 6:109342721-109342743 GCTGGAGAGGAGGGAGGAGAAGG - Intergenic
1013429067 6:110039940-110039962 GCTGAGGGGAAGTAAAGAGAGGG - Intergenic
1013630806 6:111984229-111984251 GCTGAGGAGGAGGCAGTAGATGG + Intergenic
1013803271 6:113970752-113970774 GCTGAGGGGTGGGAAGGAGGAGG - Intronic
1014070120 6:117171650-117171672 GAAGTTGGGGAGCAAGGAGAAGG + Intergenic
1014275754 6:119386412-119386434 GGGGATGGGGAGCAAGGGGAGGG + Intergenic
1014930703 6:127332572-127332594 GGTGGTGGGGAGGCAGGAGGTGG + Intronic
1014947557 6:127515947-127515969 GCAGAAGAGGAGGATGGAGAAGG + Exonic
1015153452 6:130064264-130064286 GCTGCTAGGGAGGAAGTAAAAGG + Intronic
1015208893 6:130672875-130672897 GATGAGGGGGCGGGAGGAGAGGG - Intergenic
1015386445 6:132629660-132629682 GTGGATGAGGAGTAAGGAGAAGG + Intergenic
1015399139 6:132768680-132768702 GCTGATGTGGAGGGAGGAGAGGG - Intergenic
1015754436 6:136593378-136593400 GCAGATGGGGAAGAAAGAGTAGG + Intronic
1015888699 6:137947133-137947155 GCGGATGGGGAGGAGGGGCATGG - Intergenic
1016190522 6:141260152-141260174 GGAGATTGGGAGGAAGGCGAGGG + Intergenic
1017264194 6:152423431-152423453 GTTGGTGGGGAGGGAGGAGTGGG - Intronic
1017267200 6:152461267-152461289 GATGAGGAGGAGGAAGAAGAGGG - Intronic
1017686644 6:156920170-156920192 GCTGAAGGGGAGGGAGGTGAAGG - Intronic
1017847413 6:158271346-158271368 GTTGATGAGGAGGAAGGGCAAGG + Intronic
1017881638 6:158566398-158566420 GATGATGGTGAGGGAGGTGATGG + Intronic
1017881651 6:158566456-158566478 GGTGATGGTGAGGGAGGTGATGG + Intronic
1017887095 6:158608345-158608367 GCTGTTGACCAGGAAGGAGAGGG - Exonic
1018428102 6:163701157-163701179 GCTGGCAGGGAGGTAGGAGAGGG + Intergenic
1018839566 6:167508198-167508220 GGGGATGGGGAGGAGGGGGATGG - Intergenic
1018907653 6:168084827-168084849 TGTGATGGGGAGGAATGAGGTGG - Intergenic
1018960966 6:168448345-168448367 GCTGGGGAGGAGGATGGAGATGG + Intronic
1018961038 6:168448585-168448607 GGTGATGGGGAGGACGATGATGG + Intronic
1018961049 6:168448618-168448640 GGTGATGGGGAGGATGGTGATGG + Intronic
1018996530 6:168714584-168714606 GATGATGGTGAGGAGGAAGAGGG + Intergenic
1019133008 6:169891054-169891076 GAGGACGTGGAGGAAGGAGATGG + Intergenic
1019180377 6:170183638-170183660 GGTGATGGTGATGATGGAGATGG + Intergenic
1019180404 6:170183844-170183866 GATGATGGGGATGAGGGTGATGG + Intergenic
1019353496 7:566661-566683 GGTGATGGTGATGAAGGTGATGG - Intronic
1019353597 7:567475-567497 GGTGATGGTGATGAAGGTGATGG - Intronic
1019353601 7:567505-567527 GGTGATGGTGATGAAGGTGATGG - Intronic
1019353606 7:567553-567575 GGTGATGGTGATGAAGGTGATGG - Intronic
1019449878 7:1091925-1091947 GCCGATGGGGAAGAGGAAGATGG - Exonic
1019465904 7:1188789-1188811 GGAGAAGGGGAAGAAGGAGAAGG + Intergenic
1019490241 7:1309587-1309609 GGTGATGGTGATGAAGGTGATGG + Intergenic
1019776108 7:2912983-2913005 GGTGATGGGGAGGAGGAGGAGGG + Intronic
1019903398 7:4042235-4042257 GTGGATGGGGAAGAAGGAGGTGG - Intronic
1019924400 7:4182613-4182635 CCTGAGGGAGAGGAGGGAGAAGG + Intronic
1020002145 7:4762162-4762184 GCTGGAGTGGAGGAAGAAGAGGG - Exonic
1020118905 7:5491921-5491943 GCTGGTGTGGGGGAGGGAGAGGG + Intronic
1020260557 7:6528581-6528603 GATGAGGGGGAGAAGGGAGAAGG + Intronic
1021171182 7:17399543-17399565 GCTGAGGAGGAGGAAGAGGAGGG + Intergenic
1021364495 7:19760099-19760121 CCTGAGGGGGAGGAGGTAGAAGG - Intronic
1021897909 7:25255032-25255054 GGTGATGGGGAGAAATGAGATGG - Intergenic
1022077122 7:26982902-26982924 GCTGAAGGAGAAGTAGGAGAAGG - Intronic
1022096904 7:27146882-27146904 TCTGAAGGGCAGAAAGGAGAGGG + Intronic
1022505562 7:30907064-30907086 GCAGCTGGGGAGGAGGGCGATGG + Intergenic
1022542382 7:31149703-31149725 GTTGGTGGGGAGCAAGGGGAGGG + Intergenic
1022633218 7:32105647-32105669 GCTGCTTGGGAGGATGAAGAGGG - Intronic
1022725373 7:32976478-32976500 GCCTATGGAGAGGATGGAGATGG + Exonic
1022827003 7:34025301-34025323 GCTGTGGGGAAGGAAGTAGAGGG + Intronic
1022976515 7:35562643-35562665 GATGTTGGGGAGGAAAGAAAGGG - Intergenic
1023149415 7:37186768-37186790 GCTGATGGGAGGGAATGGGAGGG - Intronic
1023620532 7:42067457-42067479 TCTGATGGGGAGTGGGGAGAGGG - Intronic
1023821499 7:43983105-43983127 GCTGATGGGCAGGTAGGGGAGGG - Intergenic
1024184612 7:46937389-46937411 GCTTCTGGGATGGAAGGAGAGGG - Intergenic
1024520377 7:50300596-50300618 GCTGCTGGGGGTGAAGGAGCAGG - Intergenic
1024636003 7:51290943-51290965 GCTCTTGGGGAGGATGGTGAGGG - Intronic
1024859275 7:53818746-53818768 GCTGAAGAGGAGGAGGGAGAGGG - Intergenic
1024922525 7:54574625-54574647 GCTACTAGGGAGGAAAGAGAAGG + Intergenic
1025048239 7:55711362-55711384 GCCTATGGAGAGGATGGAGATGG - Intergenic
1025058041 7:55780962-55780984 GAGGAGGAGGAGGAAGGAGAAGG + Intergenic
1025279539 7:57616754-57616776 GGTGATGATGAGGAAGGTGATGG + Intergenic
1025282236 7:57636458-57636480 GATGATGGTGAGGATGGTGACGG + Intergenic
1025302494 7:57829061-57829083 GATGATGGTGAGGATGGTGACGG - Intergenic
1025305192 7:57848746-57848768 GGTGATGATGAGGAAGGTGATGG - Intergenic
1026122516 7:67550301-67550323 GAAGAGAGGGAGGAAGGAGAGGG - Intergenic
1026187768 7:68095690-68095712 GGTGGTGGGGAGCAAGGGGAGGG + Intergenic
1026799931 7:73393664-73393686 GCTAATGGGAAGCAAGCAGAAGG + Intergenic
1027545223 7:79519182-79519204 GGAGAAGGGGAAGAAGGAGAGGG + Intergenic
1027753832 7:82185527-82185549 GAGGAGGGGGAGGAAGGGGAGGG + Intronic
1027980361 7:85211729-85211751 GCTGAGGAGGAGGAAGATGAGGG - Intergenic
1028246859 7:88489701-88489723 GATGGTGAGGAGGAAGGAGAAGG - Intergenic
1028606558 7:92662192-92662214 ACTGGAGGGAAGGAAGGAGAAGG + Intronic
1028618547 7:92798719-92798741 GTTGAAGAGGAGGAAGCAGAGGG - Intronic
1029200356 7:98835263-98835285 GATGATGGGAAGGAGGAAGAGGG - Intergenic
1029412829 7:100426811-100426833 GAGGAGGGGGAGAAAGGAGAGGG - Intronic
1029465561 7:100722601-100722623 GCTGAGGGGCAGGAGGGAGAGGG + Intronic
1029543930 7:101200579-101200601 TCTGAAGGGGAGGAAGGGAAGGG - Intronic
1029749761 7:102536526-102536548 GCTGATGGGCAGGTAGGGGAGGG - Intergenic
1029767711 7:102635631-102635653 GCTGATGGGCAGGTAGGGGAGGG - Intronic
1029950354 7:104577703-104577725 GCTAATGGCTAGGCAGGAGATGG + Intronic
1030002734 7:105082645-105082667 GTAGAAGGGGAGGCAGGAGAGGG + Intronic
1030308737 7:108047354-108047376 GCTGAGGAGGAGGAAGAAGAGGG - Intronic
1030388885 7:108900771-108900793 GCTGATGTGGGAGAATGAGAGGG - Intergenic
1030558540 7:111056846-111056868 GCTGAGGAGGAGGAAGAGGAGGG + Intronic
1030871422 7:114760661-114760683 GAAGATGGGGAGGGAGTAGATGG - Intergenic
1031099498 7:117462006-117462028 GGGGGTGGGGAGCAAGGAGAGGG - Intergenic
1031329836 7:120451003-120451025 GGAGAAGGGAAGGAAGGAGAGGG - Intronic
1031434771 7:121719710-121719732 ACTAAGGGGGAGGAAGAAGAGGG - Intergenic
1031969735 7:128055408-128055430 GCAGCAGGGGAGGAAGGAAATGG + Intronic
1032389840 7:131548803-131548825 GCATATGGGCAGGAAGGAGCAGG - Intronic
1032523563 7:132563177-132563199 GAGGAGGAGGAGGAAGGAGAAGG - Intronic
1032523621 7:132563422-132563444 GAAGAGGAGGAGGAAGGAGAAGG - Intronic
1032544164 7:132727996-132728018 GCTGAGGGGGATGAAGAAAAGGG + Exonic
1032807490 7:135371469-135371491 GCTGATGTGGAAGAGGGAAAGGG + Intronic
1034077393 7:148245423-148245445 GCTGATGTGGAGGAGGATGAAGG + Intronic
1034253946 7:149714523-149714545 GCTGATGGTGGGGATGAAGAGGG - Intergenic
1034434590 7:151057314-151057336 GCAGGTGGGGAGGGAGGAGAAGG + Intronic
1034447671 7:151121871-151121893 GCTGCTGGGGAGGACGATGAGGG - Intronic
1034470736 7:151253131-151253153 GCAGACTGGGAGGAAGGAGGGGG + Intronic
1034521680 7:151625397-151625419 GAGGCTGGGGAGGGAGGAGAAGG + Intronic
1034528139 7:151679036-151679058 TGGGGTGGGGAGGAAGGAGAGGG + Intronic
1034621394 7:152459980-152460002 TTTGAGGGGGAGGAAGGAGGAGG + Intergenic
1034717458 7:153256706-153256728 GCTGCTGGGCAAGAAGGAAATGG + Intergenic
1034858900 7:154579716-154579738 GCAGATGGGCAGCAGGGAGATGG + Intronic
1034966108 7:155392142-155392164 GCTGGTGAGGTGGCAGGAGAAGG - Intronic
1035081403 7:156219444-156219466 GATGCTGGGGAGGAAGCAGCAGG - Intergenic
1035177155 7:157059662-157059684 CCTGCTGGGCAGGATGGAGAGGG - Intergenic
1035195271 7:157214089-157214111 GGAGATGGGGAGAAAGGAGGAGG - Intronic
1035574568 8:696505-696527 GCTGATGGGGAGGAAGGAGAGGG - Intronic
1035574579 8:696550-696572 GCTGATGGGGAGGAAGGAGAGGG - Intronic
1035574646 8:696853-696875 GCTGATGGGGAGGAAGGAGAGGG - Intronic
1035574657 8:696898-696920 GCTGATGGGGAGGAAGGAGAGGG - Intronic
1035754922 8:2023851-2023873 GCTGCAGGGGAGGAAGCAGCAGG + Intergenic
1035842225 8:2825501-2825523 GAGGAGGGGGAGGAAGGCGAGGG - Intergenic
1035908064 8:3535548-3535570 GCTGGTGGGTAGGAAGAAGAAGG + Intronic
1035989324 8:4470277-4470299 GTTGAAGGAGAGGAGGGAGAAGG - Intronic
1036137402 8:6174754-6174776 GGAGAGGGGGAGGGAGGAGAGGG + Intergenic
1036163067 8:6406827-6406849 GCAGCGGGGGAGGAAGGAGGCGG - Intronic
1036444588 8:8810490-8810512 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
1036444630 8:8810868-8810890 AAGGAAGGGGAGGAAGGAGAAGG + Intronic
1036494108 8:9253736-9253758 GCTGGAGAGGAGGAAGAAGAGGG + Intergenic
1036619772 8:10416853-10416875 GAGGACGGGGAGGATGGAGAAGG - Intronic
1036629068 8:10497567-10497589 ACTGAAGGTGAGGAAGGTGAAGG + Intergenic
1036657914 8:10689862-10689884 GCGGAGGGGGAGGAAGAGGAGGG + Intronic
1036698231 8:10993398-10993420 GCTGGTGAGGAGGGAGGAGGCGG + Intronic
1036803424 8:11809799-11809821 GTTCATGGAGAGCAAGGAGAAGG + Exonic
1037084647 8:14833648-14833670 GCAGATGGGGACGAAGGAAGGGG + Intronic
1037348008 8:17920371-17920393 AGTGATGGGGAGGTGGGAGAAGG - Intergenic
1037469219 8:19191045-19191067 GCTGTTGGGGATGTTGGAGATGG - Intergenic
1037500608 8:19482125-19482147 GCTGAAAGAGAGGAAGGAAATGG - Intronic
1037751812 8:21687130-21687152 GCTGCTGGAGACGGAGGAGAAGG + Intergenic
1037945549 8:22987419-22987441 GCTTATGGGAAGGCAGGTGAAGG - Exonic
1038016942 8:23523421-23523443 GCAGGGAGGGAGGAAGGAGAGGG + Intergenic
1038150931 8:24942066-24942088 GAGGTTGGGGAGGAAGGAGGAGG - Intergenic
1038215144 8:25555155-25555177 TCTGGTGGGGAGGATGTAGAGGG - Intergenic
1038313414 8:26463157-26463179 GAGGAGGAGGAGGAAGGAGAAGG - Intronic
1038394866 8:27239188-27239210 GTGGATGGGCAGGAAGGAGCGGG + Intronic
1038428356 8:27479916-27479938 GCTGAAGGGAAGGAACGAGTGGG - Intergenic
1038491927 8:27977622-27977644 GTTTTTAGGGAGGAAGGAGAGGG - Intronic
1038775311 8:30525355-30525377 GCGGAGGAGGAGGAAGGAGAAGG - Intronic
1039404754 8:37303015-37303037 GCGCATAGGGAGGAAGAAGAGGG - Intergenic
1039454689 8:37698720-37698742 GCAGGTGGGGAGGGAGGAGGAGG - Exonic
1039691267 8:39867443-39867465 AGTGATGGGGAGGAAGGAAGAGG - Intergenic
1039691286 8:39867596-39867618 GAAGAAGAGGAGGAAGGAGAAGG - Intergenic
1040468504 8:47716979-47717001 GATGATTGGCAGGAAGAAGAGGG + Intronic
1040592785 8:48810473-48810495 GCAGAAGCGGAAGAAGGAGAAGG - Intergenic
1040857912 8:51969541-51969563 TCCAATGAGGAGGAAGGAGAGGG - Intergenic
1041348108 8:56922389-56922411 GCTGATGGGTAGGAAGGGGAAGG - Intergenic
1041368104 8:57130662-57130684 GCTGAGGGAGGGGAAGGAGCAGG - Intergenic
1041444237 8:57932085-57932107 GCAGGGAGGGAGGAAGGAGAAGG + Intergenic
1041525819 8:58804366-58804388 GCTGAGGAGGAGGAGGAAGAAGG - Intergenic
1041772668 8:61488857-61488879 GCAGATGGGGAGGAAGGAATGGG - Intronic
1041791104 8:61697090-61697112 GCAAATGGGGAGGAAAGTGAGGG + Intronic
1041854686 8:62438182-62438204 GCTGATAGGAAGGGACGAGAGGG - Intronic
1042359369 8:67865230-67865252 TCAGGTGGGGAGTAAGGAGAAGG + Intergenic
1042840257 8:73116612-73116634 GGTGATGGGCAGGAAGGAGGTGG + Intronic
1043552637 8:81392087-81392109 GGTGATGGGGGGCAAGGGGAGGG + Intergenic
1043574533 8:81642773-81642795 GAAGAGGGAGAGGAAGGAGAAGG + Intergenic
1044169694 8:89034190-89034212 ACTGGAGGGGAGGAAGGAGGAGG + Intergenic
1045025208 8:98080577-98080599 GGTGAAGGAGAAGAAGGAGAAGG - Intronic
1045145040 8:99333657-99333679 GATGGTGAGGAGGAAGCAGAAGG - Intronic
1045156481 8:99479597-99479619 TGTGATGGGGAGGAATGGGAGGG - Intronic
1045266556 8:100623502-100623524 GCTGGTGGGAAGGAGGGAGGAGG - Intronic
1045559815 8:103250206-103250228 GGTGATGAGGAGGAAGAAGAGGG - Intergenic
1045971329 8:108082718-108082740 GCTGCTGGGGAGGACTCAGAGGG + Exonic
1046270351 8:111888640-111888662 GCTGAGGAGGAAGAAGAAGAAGG + Intergenic
1046497435 8:115033710-115033732 GTTGGTGTGAAGGAAGGAGAAGG - Intergenic
1046550366 8:115708347-115708369 GCTGCTGGTGGGGAAAGAGATGG - Intronic
1046765609 8:118066189-118066211 GCTGAGGAGGAGGAAGATGAGGG - Intronic
1047254801 8:123207042-123207064 GAGGAGGTGGAGGAAGGAGAAGG - Intronic
1047350132 8:124065867-124065889 ATTGATGGGGTGGCAGGAGAGGG - Intronic
1047361767 8:124175649-124175671 GCTGATGGGGAAGGAAGAGGAGG - Intergenic
1047641832 8:126828765-126828787 AAAGATGGGAAGGAAGGAGAAGG - Intergenic
1047708221 8:127523722-127523744 GCTGATGAGGAACAAGGAGAGGG + Intergenic
1047718783 8:127619796-127619818 GGGTAAGGGGAGGAAGGAGAGGG - Intergenic
1047719660 8:127627838-127627860 GCTAATGGGGAGGACAGAGTGGG - Intergenic
1047731991 8:127735937-127735959 GCTTATGGGGAGGGTGGGGAGGG - Intronic
1048161384 8:132024860-132024882 GAAGATGGGGAGGAAGGAGAAGG - Intronic
1048299338 8:133239750-133239772 GCTGATGGGGTGGAATGAGGAGG + Intronic
1048426136 8:134325612-134325634 ATTGATGGGGTGGGAGGAGAAGG - Intergenic
1048507394 8:135033839-135033861 GTTGATCGGTAGGAAGGTGAGGG + Intergenic
1048674389 8:136761772-136761794 GGAGATGGGGAGCAAGGGGAGGG - Intergenic
1049046673 8:140157420-140157442 GGTGGAGGGGAGGGAGGAGAAGG + Intronic
1049168148 8:141139798-141139820 GCTGCTGGGAAGGCAGGAGCAGG - Intronic
1049210591 8:141384787-141384809 ACTGGTGGGGACGAGGGAGATGG + Intergenic
1049210770 8:141385463-141385485 GAAGAAGGGGAGGAGGGAGAAGG - Intergenic
1049324082 8:142012848-142012870 GCTGATGGTGATGGTGGAGATGG - Intergenic
1049443941 8:142621585-142621607 GCTGGTGGGGAGGATGGAAAAGG + Intergenic
1049594257 8:143476204-143476226 GATGAAGGGGAGGCAGGACAGGG - Intronic
1049680782 8:143917044-143917066 GCTGATGGGGTAGGAGGAGGAGG + Exonic
1049690885 8:143958361-143958383 GCTGCAGGGGAGAGAGGAGAAGG - Intronic
1049825064 8:144662744-144662766 GATAATGGGGAGGAGGGAGCTGG - Intergenic
1049883469 9:13253-13275 CCTGAGGCTGAGGAAGGAGAAGG + Intergenic
1049942945 9:566000-566022 GAGGTTGGGGAGGAAGCAGAGGG - Intronic
1050153687 9:2643316-2643338 GCTGATGGGGATGCAGGAGGAGG - Exonic
1050324949 9:4490099-4490121 GCTGGTGTGGAGAACGGAGAGGG + Intergenic
1050344907 9:4676776-4676798 GATGCTGGGGAGGAGGGATAGGG + Intergenic
1050396698 9:5205420-5205442 GCTGATGGGTAGGAAGATGGTGG - Intergenic
1050594709 9:7194081-7194103 GCCAAGGGGGAGGAGGGAGAAGG - Intergenic
1050675797 9:8051841-8051863 GGGGAAGGGAAGGAAGGAGAAGG + Intergenic
1050840722 9:10145367-10145389 GCTGAGGAGGAGGAAGAAGAGGG - Intronic
1051783955 9:20721878-20721900 GGGGAGGGGGAGGAAGGGGAGGG - Intronic
1051857678 9:21587827-21587849 GTTGATGGGATGGCAGGAGAAGG + Intergenic
1051921238 9:22268301-22268323 GCTGATGGTGAGGAAAGGCAAGG - Intergenic
1052077270 9:24158781-24158803 GCAGGAGGGGAGGAGGGAGAGGG - Intergenic
1052219451 9:26001793-26001815 GGGGATGGGGAGCAAGGGGAGGG - Intergenic
1052302247 9:26965772-26965794 GATGAGTGGGAGGAAGGTGAGGG - Intronic
1052457692 9:28721659-28721681 GGGGATGGGGAGAATGGAGAGGG + Intergenic
1052841710 9:33297119-33297141 GCTGATTTGCAGTAAGGAGAGGG - Intronic
1053186562 9:36021508-36021530 GCTGATGGGGAATGAGGAGGAGG + Intergenic
1053204067 9:36171688-36171710 TCTCATGGCCAGGAAGGAGAAGG + Intergenic
1053263592 9:36693944-36693966 GAGGAGGAGGAGGAAGGAGAGGG - Intergenic
1053424440 9:38001891-38001913 GCTCATGGGGAGGATGCAGATGG - Intronic
1053517096 9:38739837-38739859 GATAATGAGGAGGAAGAAGAGGG + Intergenic
1053785336 9:41648958-41648980 TTTCATGCGGAGGAAGGAGAGGG + Intergenic
1053915095 9:42939882-42939904 GCGGTTGGGGTGGAAGGAAAAGG + Intergenic
1054174061 9:61862910-61862932 TTTCATGCGGAGGAAGGAGAGGG + Intergenic
1054448918 9:65391977-65391999 TTTCATGCGGAGGAAGGAGAGGG + Intergenic
1054455871 9:65430118-65430140 CCTGATGGGGAGGTGGGAGGGGG + Intergenic
1054663477 9:67717871-67717893 TTTCATGCGGAGGAAGGAGAGGG - Intergenic
1054947379 9:70810256-70810278 GGTGATGGAGAGGAGGGTGAGGG - Intronic
1055248159 9:74271941-74271963 TCTGATGGGCAGGAAGAAAATGG + Intergenic
1055436545 9:76297441-76297463 GCTTCTGAGGAGGGAGGAGAGGG + Intronic
1055552584 9:77445114-77445136 CCTGATGGCGGGGAAGGAGAAGG + Intronic
1055582662 9:77723774-77723796 GGTTAGGGGGAGGAAGGAAATGG + Intronic
1055681565 9:78721048-78721070 GCTGAGGAGGAGGATGGGGAGGG + Intergenic
1055980497 9:81995508-81995530 GTGAATGGGGAGGAAGGTGAAGG - Intergenic
1056340611 9:85627698-85627720 GCTGAAGAGCAGGAAGAAGAAGG - Intronic
1056437468 9:86588108-86588130 GCCGCTGAGGATGAAGGAGAAGG + Intergenic
1056768650 9:89460908-89460930 GCCGAAGGGGAGGACGGAGAAGG + Intronic
1056914782 9:90736647-90736669 GCTGCTGGGGAGGGTGCAGAAGG + Intergenic
1057082959 9:92186701-92186723 GATGAGGGAGGGGAAGGAGAGGG - Intergenic
1057303576 9:93900027-93900049 GCTGATGGAGGGGAAGGGAAGGG - Intergenic
1057357969 9:94347337-94347359 GGTGATGGTGAGGAAGAGGATGG - Intergenic
1057497426 9:95571992-95572014 GGAGATGGTGAGGGAGGAGAGGG + Intergenic
1057649781 9:96910280-96910302 GGTGATGGTGAGGAAGAGGATGG + Intronic
1057736514 9:97667029-97667051 GCAGAAGAGGAGGAAGGAGCAGG + Intronic
1057974118 9:99585883-99585905 ACTTTTGGGGAGCAAGGAGAAGG + Intergenic
1058188201 9:101880758-101880780 AGTGATGGGGAGGTAGGAGATGG + Intergenic
1058422271 9:104843319-104843341 GGTGATGGGAAGGGAGGACAGGG - Intronic
1058504124 9:105651904-105651926 GCTCCTGGGGAGGAAACAGAGGG - Intergenic
1058574044 9:106381041-106381063 GCTGCTGGCAAGGATGGAGAAGG - Intergenic
1058627868 9:106953975-106953997 GAGGATGGGAAGGAGGGAGATGG - Intronic
1058858568 9:109091089-109091111 GGTGAAGGGGAGGAGGGTGAAGG + Exonic
1058913284 9:109541017-109541039 GAGGAGGAGGAGGAAGGAGAAGG - Intergenic
1058935090 9:109762863-109762885 GGTGGAGGGGAGGAAAGAGATGG + Intronic
1059072418 9:111152802-111152824 GCAGAGGAGGAGGAAGGAGGCGG + Intergenic
1059125789 9:111683435-111683457 GCTGAGAGTGAAGAAGGAGAAGG - Intergenic
1059161314 9:112037881-112037903 GCTTCTGGGGAGGAAGGATGTGG - Intergenic
1060003730 9:119981372-119981394 GCTGATGGGGAGACAGGGCAGGG - Intergenic
1060079747 9:120631897-120631919 GGAGAAGGTGAGGAAGGAGAAGG - Intronic
1060234579 9:121853432-121853454 GGTGGTGGTGAGCAAGGAGAGGG + Intronic
1060332462 9:122685828-122685850 GCGGATGGGGAGGAGGGAAAGGG - Intergenic
1060369839 9:123058061-123058083 GGAGAGGGGGAGGAGGGAGAGGG + Intronic
1060371842 9:123081018-123081040 GCTGAGGAGGAGGAGGAAGAGGG - Intronic
1060694539 9:125696297-125696319 GCTGCTGGGGAGGAAGAGGTGGG + Intronic
1060968749 9:127726094-127726116 CCTGATGGAGAGAGAGGAGAGGG + Intronic
1061038131 9:128124723-128124745 GCCAATGGGGAGGAAGGTGTGGG + Intronic
1061207888 9:129174959-129174981 GCGGGTGGGAGGGAAGGAGAGGG + Intergenic
1061237598 9:129351673-129351695 GAGGATGGGGAGGAAGATGAGGG + Intergenic
1061308104 9:129744174-129744196 GGTGATGGCGATGGAGGAGATGG - Intronic
1061373685 9:130212004-130212026 GCAGGTGGGGAGGAGGGGGAAGG + Intronic
1061653840 9:132072563-132072585 GCAGGTGGGGAGGGAGGAGGAGG + Intronic
1061766028 9:132882035-132882057 GCTGAAGGTGGGGAATGAGATGG - Intronic
1061801443 9:133115312-133115334 GCTGAAGCGGAGTGAGGAGAGGG + Intronic
1062097872 9:134712148-134712170 GAAGATGGGCAGGAAGGAGGAGG - Intronic
1062290397 9:135791821-135791843 GTTGATGAGGACGTAGGAGAGGG - Exonic
1062323759 9:136003066-136003088 GCTGGAGGGGAGGGAGGAGCGGG + Intergenic
1062392153 9:136338124-136338146 GCTCATGGGGAGGCAGGCGGTGG + Intronic
1062407268 9:136403021-136403043 TCTGAGTGGGAGGAAGGCGAGGG + Intronic
1203626832 Un_KI270750v1:33018-33040 GCGGCTGGAGAGGTAGGAGAAGG - Intergenic
1203633300 Un_KI270750v1:90063-90085 GATGATGGTGAGGATGGTGATGG + Intergenic
1185485912 X:481745-481767 GGAGACAGGGAGGAAGGAGAGGG + Intergenic
1185485954 X:481887-481909 GGAGACAGGGAGGAAGGAGAGGG + Intergenic
1185689017 X:2137738-2137760 GATGATGGTGAGGATGGTGATGG - Intergenic
1185689022 X:2137798-2137820 GATGATGGTGAGGATGGTGATGG - Intergenic
1185689050 X:2138037-2138059 GATGATGGTGAGGATGGTGATGG - Intergenic
1185714566 X:2330654-2330676 GATGAAGGAGAAGAAGGAGAAGG + Intronic
1185739592 X:2520502-2520524 GATGATGGTGAGGATGGTGATGG - Intergenic
1186559126 X:10591689-10591711 GCTGATAGGCAGGGAGGTGAAGG - Intronic
1187026595 X:15441672-15441694 GATGAGGGGGAGGCAGGAGGTGG + Intronic
1187144533 X:16625715-16625737 ATGGATGGGGAGGAAGGAGATGG + Intronic
1187342790 X:18436294-18436316 GTGGAAGGGGAGGCAGGAGAGGG + Intronic
1187499009 X:19823132-19823154 GCTGAGTGGGAGGATGGGGATGG + Intronic
1187507409 X:19888171-19888193 GCTGTTGGAGGGGAAGGAAAAGG + Intergenic
1187531460 X:20100612-20100634 GCTGGGGGGGAGGGAGGGGAAGG + Intronic
1187709000 X:22035301-22035323 GATTGTGGGGAGGAAAGAGAGGG - Intronic
1189110534 X:38285904-38285926 GTGGAAGGGGAGGAAGGAGAGGG - Exonic
1189110579 X:38286036-38286058 GGGGAAGAGGAGGAAGGAGAAGG - Exonic
1189110589 X:38286063-38286085 GGGGAAGGGGAGGAAGGAGAAGG - Exonic
1189110606 X:38286108-38286130 GGGGAAGAGGAGGAAGGAGAAGG - Exonic
1189110625 X:38286162-38286184 GGGGAAGGGGAGGATGGAGAAGG - Exonic
1189110633 X:38286183-38286205 GGGGAAGAGGAGGAAGGAGAAGG - Exonic
1189110643 X:38286210-38286232 GAGGAAGGAGAGGAAGGAGAAGG - Exonic
1189110653 X:38286243-38286265 GGAGAAGAGGAGGAAGGAGAAGG - Exonic
1189110668 X:38286294-38286316 GGAGAAGAGGAGGAAGGAGAAGG - Exonic
1189110683 X:38286345-38286367 GGGGAAGAGGAGGAAGGAGAAGG - Exonic
1189110693 X:38286372-38286394 GAAGAAGGGGAGGAAGGAGAAGG - Exonic
1189110702 X:38286399-38286421 GAAGAAGGGGAAGAAGGAGAAGG - Exonic
1189110712 X:38286432-38286454 GGGGAAGAGGAGGAAGGAGAAGG - Exonic
1189341511 X:40207947-40207969 GCTACTGGGGAAGAAGGAGGGGG + Intergenic
1189882308 X:45504871-45504893 GGAGATGGAGAGGAGGGAGAGGG + Intergenic
1189911026 X:45810665-45810687 GCAGGTGGGGAGGGAAGAGATGG - Intergenic
1190324812 X:49199983-49200005 GGTGAAGGGGAGGAAGGGGGAGG - Intronic
1190559010 X:51669197-51669219 GCAGATGGGGAAGAAAGAGTAGG + Intergenic
1190565281 X:51724125-51724147 GCAGATGGGGAAGAAAGAGTAGG - Intergenic
1190595063 X:52044140-52044162 GAGGATGGGCAGGAAGGTGAAGG + Intergenic
1190613761 X:52209933-52209955 GAGGATGGGCAGGAAGGTGAAGG - Intergenic
1190781298 X:53598473-53598495 GCTGAGGAGGAGGAAGGAAGTGG - Intronic
1190795039 X:53733056-53733078 ACTGAGGAGGAGGAAGAAGAGGG - Intergenic
1191790767 X:64969766-64969788 GCTAATGGTGTGGATGGAGAGGG + Intronic
1192130407 X:68544246-68544268 GCTGTGGGGGAGGGAGGAAAGGG + Intergenic
1192772135 X:74204014-74204036 GGTGACGGGGAAGAAGGACATGG + Intergenic
1194600746 X:95918857-95918879 GATAATGGGGAGGAAGAAGATGG - Intergenic
1195129360 X:101838907-101838929 GCTAACCAGGAGGAAGGAGAGGG - Intronic
1195176877 X:102320922-102320944 GCTAACCAGGAGGAAGGAGAGGG + Intronic
1195181987 X:102366171-102366193 GCTAACCAGGAGGAAGGAGAGGG - Intronic
1195202739 X:102565602-102565624 GCTAACCAGGAGGAAGGAGAGGG + Intergenic
1195272010 X:103241661-103241683 GATGAGGAGGAGGAAGGAGATGG - Intergenic
1195967875 X:110445483-110445505 GCTGTGGGGGAGGAAGGAAGTGG + Intronic
1196387435 X:115173796-115173818 GCTGAAGAGGAGGAAGAGGAGGG - Intronic
1196547618 X:116981461-116981483 GCGGATGGGGGGCTAGGAGAGGG + Intergenic
1196736714 X:118986852-118986874 GGTGAAGGGGAGGAGGGTGAAGG - Intronic
1196893533 X:120311575-120311597 ACTGAGGGGGAGGGAGGAGGGGG - Intergenic
1198557584 X:137811647-137811669 GCTAATAGGGAGCAAGCAGAAGG - Intergenic
1198985714 X:142450609-142450631 GCTGAGGGCCAGGAAGGGGAGGG - Intergenic
1199034555 X:143034341-143034363 GATGGTGGGGAGGAAGGGAAGGG + Intronic
1199411479 X:147528622-147528644 TCTGATGGGGGGGGAGGAGGAGG - Intergenic
1199874668 X:151920665-151920687 GCTGATGGGGATGAAGGTAGGGG - Intronic
1199949998 X:152699514-152699536 AGTCATGGGGAGGAAGAAGAGGG + Intronic
1199959676 X:152768947-152768969 AGTCATGGGGAGGAAGAAGAGGG - Intronic
1200402347 X:156026896-156026918 CCTGAGGCTGAGGAAGGAGAAGG - Intergenic
1201337450 Y:12895881-12895903 TCTAATGGGGAGGAAGAAGAGGG - Intergenic
1201440412 Y:14001603-14001625 GATGACGGAGAGGAGGGAGAGGG + Intergenic
1201444159 Y:14041105-14041127 GATGACGGAGAGGAGGGAGAGGG - Intergenic
1201461726 Y:14232958-14232980 GATGAGGAGGAGGAAGAAGAAGG - Intergenic
1201465494 Y:14275924-14275946 GAGGATGGGGAGGAAAGAGGTGG - Intergenic
1201607306 Y:15801111-15801133 GCTGAGGAGGAGGAAGAGGAGGG + Intergenic
1201963612 Y:19708127-19708149 GCACCTGGGTAGGAAGGAGAGGG - Intronic