ID: 1035575024

View in Genome Browser
Species Human (GRCh38)
Location 8:698866-698888
Sequence AACCATAGGATGCTACTTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 44}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035575024_1035575029 26 Left 1035575024 8:698866-698888 CCACGAAGTAGCATCCTATGGTT 0: 1
1: 0
2: 0
3: 1
4: 44
Right 1035575029 8:698915-698937 TTTAACCAGGGAGGCTCTCCAGG No data
1035575024_1035575027 14 Left 1035575024 8:698866-698888 CCACGAAGTAGCATCCTATGGTT 0: 1
1: 0
2: 0
3: 1
4: 44
Right 1035575027 8:698903-698925 TTTTTTTTTTTTTTTAACCAGGG No data
1035575024_1035575028 17 Left 1035575024 8:698866-698888 CCACGAAGTAGCATCCTATGGTT 0: 1
1: 0
2: 0
3: 1
4: 44
Right 1035575028 8:698906-698928 TTTTTTTTTTTTAACCAGGGAGG No data
1035575024_1035575026 13 Left 1035575024 8:698866-698888 CCACGAAGTAGCATCCTATGGTT 0: 1
1: 0
2: 0
3: 1
4: 44
Right 1035575026 8:698902-698924 TTTTTTTTTTTTTTTTAACCAGG 0: 32
1: 577
2: 7520
3: 125675
4: 146074

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035575024 Original CRISPR AACCATAGGATGCTACTTCG TGG (reversed) Intronic
912024753 1:105155393-105155415 TACCATAAGATGGTACTTAGTGG - Intergenic
918754645 1:188323915-188323937 AACCAAACGATCCTACTTCTAGG + Intergenic
921548157 1:216498732-216498754 ATGCATAGGAGGCTGCTTCGGGG - Intergenic
1093160384 12:15740021-15740043 AACCAAAAGAAGCTACTCCGAGG + Intronic
1102694990 12:114791895-114791917 AACCAAAGGAGACTGCTTCGTGG - Intergenic
1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG + Intronic
1118868714 14:69723829-69723851 AACCATAGCATTCTACTTGCAGG + Intergenic
1121536927 14:94697359-94697381 AATTATAGGATGCTTCTTCTGGG + Intergenic
1130316448 15:82800790-82800812 AACCATAAGCTCCTATTTCGGGG + Intronic
1144886953 17:18469721-18469743 AATCATAGCATGCTACTGTGTGG + Intergenic
1145145262 17:20474574-20474596 AATCATAGCATGCTACTGTGTGG - Intergenic
1146353680 17:32116797-32116819 AATCATAGCATGCTACTGTGTGG + Intergenic
1147031564 17:37641856-37641878 CACCATATGATGCTACTTTTCGG + Intronic
1148398867 17:47335989-47336011 AATCATAGGATTCTAGTTAGAGG + Intronic
1167086292 19:47311905-47311927 AACCATGGGATGCCAGTTTGTGG + Intronic
928353070 2:30580934-30580956 AACCATAAGATACTATTTTGGGG - Intronic
928816599 2:35302776-35302798 AAGCATAGGATGATACTCCCAGG - Intergenic
1173387907 20:42605701-42605723 AACCATTGGATGCTGCTGTGGGG + Intronic
1181446962 22:22984435-22984457 AACCATAGGAAACTTCTTCCTGG + Intergenic
953945345 3:47142607-47142629 AAATTTAGTATGCTACTTCGTGG + Intronic
954269898 3:49499699-49499721 AACCAAAGGATGTTGCTTGGTGG - Intronic
958811909 3:98869985-98870007 AATCATAGGGTGCTATTTTGTGG + Intronic
960490074 3:118306626-118306648 TACCATAGGATGCTCGTTAGGGG + Intergenic
962437757 3:135382407-135382429 AACCCTTGGATGCTGCTTTGTGG - Intergenic
963775891 3:149439247-149439269 AACCCTGGAATGCTACTTCTAGG + Intergenic
987788336 5:22531525-22531547 AAACATAGGATGCACCTTTGTGG + Intronic
988708638 5:33751483-33751505 AACCAGTGGATGCTTCTTCACGG + Exonic
992936796 5:81715621-81715643 AACCATAGAATACTACTACATGG + Intronic
1025800203 7:64779911-64779933 AACCTTAGGATTCTACCTGGTGG + Intergenic
1035575024 8:698866-698888 AACCATAGGATGCTACTTCGTGG - Intronic
1037262468 8:17024161-17024183 AACCATAGAAAGATACTTCATGG - Intergenic
1047246796 8:123152966-123152988 AACCATAAGATTATGCTTCGTGG - Intergenic
1049730256 8:144173719-144173741 AGCCATAGGATTCTTCTTCTTGG + Intronic
1050993787 9:12187360-12187382 ACCCAGAGGATGATACTTTGTGG - Intergenic
1057687128 9:97244830-97244852 AGCTATAAGATGCTACTTCAAGG - Intergenic
1057965233 9:99496817-99496839 AACGATAGGATGCTATTGCAGGG + Intergenic
1058748938 9:108019898-108019920 AGCCATGGGATGCTTCTTCTTGG - Intergenic
1059725959 9:117008245-117008267 ACCCATAGGAAGCAGCTTCGTGG - Exonic
1187733102 X:22276882-22276904 AAGCAAAGGATGCTAATTTGTGG - Intergenic
1189697469 X:43679532-43679554 ATCTATAGGATGCTACTGAGAGG + Intronic
1190130462 X:47743702-47743724 AACCTTAGGATGCAATCTCGTGG + Intergenic
1190719476 X:53135563-53135585 TACCATAGGATGCTTCATTGAGG + Intergenic
1194884436 X:99295497-99295519 AACCTTACAATGCTACTTGGAGG - Intergenic
1198030280 X:132747811-132747833 CACCAGAGGATGCTGCTTCTTGG + Intronic
1199860890 X:151799721-151799743 ACTCATAGGAGGCTTCTTCGAGG - Intergenic
1202093510 Y:21218916-21218938 AACCATAGAAGGCTACTTCAAGG + Intergenic